G359315


Basic Information

Item Value
gene id G359315
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000152
NCBI id null
chromosome length 3381324
location 1882977 ~ 1883380 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU409871
GAAAAATATCCATATTTAAAACTTCATAAACTATAATAACTAAAAGTCAAGTTCCAGCGGAAGAGTGACCTCTGACCCGACTTATGATGTAGGATGTAGGAGTAGCGTAAGCTTAGGCGCCTCTCGCAGTTCAAACAAATAGGGCTGGGCAACAAACTCAAGCTCCTCTTCTCTTTTATCGAAATCCTGTGACATTTCTCTTTAAAAATTCTTGTTTTCGACTTCTAATTCATGACTGGTGTTTTGTTTTGCTCTATCCTCTGCGTTTCTGTGCTCATCAATACGTCATGCGTTGGGTCAGAAGTCACTCTTCCACCAGAACTAGACTCGCGTACGGCCGTTTCCAGAAGCCAGTTATTATAGTTTATAAAGTTTTAAATATGGATATGTTTCTTACAAAAACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU409871 True 404 lncRNA 0.39 1 1882977 1883380

Neighbor

gene id symbol gene type direction distance location
CI01000152_01770267_01784486 NCAPD2 coding downstream 98491 1770091 ~ 1784486 (-)
CI01000152_01763662_01769747 ACSM3 coding downstream 113230 1763289 ~ 1769747 (-)
CI01000152_01755247_01760266 MAP6D1 coding downstream 122302 1755130 ~ 1760675 (-)
CI01000152_01584481_01585153 NA coding downstream 297709 1583831 ~ 1585268 (-)
CI01000152_01567745_01570475 PIH1D3 coding downstream 312502 1567546 ~ 1570475 (-)
CI01000152_01892421_01893463 CAMK2N2, CAMK2N1A coding upstream 8755 1890149 ~ 1893866 (-)
CI01000152_01905400_01907934 MUL1A coding upstream 20323 1903703 ~ 1907934 (-)
CI01000152_01917798_01946700 NA coding upstream 33323 1916703 ~ 1948064 (-)
CI01000152_01999033_01999195 NA coding upstream 115403 1998783 ~ 1999195 (-)
CI01000152_02006897_02010593 EIF4E2 coding upstream 122972 2006352 ~ 2010593 (-)
G359289 NA non-coding downstream 193406 1689031 ~ 1689571 (-)
G359281 NA non-coding downstream 210738 1671574 ~ 1672239 (-)
G359280 NA non-coding downstream 211943 1669793 ~ 1671034 (-)
G359277 NA non-coding downstream 219528 1662140 ~ 1663449 (-)
G359255 NA non-coding downstream 226048 1656556 ~ 1656929 (-)
G359318 NA non-coding upstream 174 1883554 ~ 1883942 (-)
G359429 NA non-coding upstream 69632 1953012 ~ 1954853 (-)
G359372 NA non-coding upstream 163002 2046382 ~ 2059154 (-)
CI01000152_02066678_02068178 NA non-coding upstream 183183 2066430 ~ 2068284 (-)
G359178 NA other downstream 538972 1337660 ~ 1344005 (-)
CI01000152_00562189_00571618 CREMA other downstream 1317693 560484 ~ 572648 (-)
CI01000152_02015257_02024292 CAPN10 other upstream 138159 2015257 ~ 2024292 (-)
G359788 NA other upstream 434888 2318268 ~ 2318734 (-)
G359800 NA other upstream 485612 2368992 ~ 2459836 (-)

Expression


Co-expression Network