XLOC_011707 (pimr22)


Basic Information

Item Value
gene id XLOC_011707
gene name pimr22
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 46739693 ~ 46740881 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00023233
agacttgtacctgaagggcccgttgctgggacgaggtggattcggctctgtgtttgctgggatgcgcaggtctgatggactgccagtggccatcaagtatgtgtcgaaggaccggacccccgagcgactgaaagttgatggtcagggtcggctgccgctggaggtggcattgatgacccgtgtcacgtcagctcctgcctgccccagtgtcctgctgctgctggactggtttgaccgtcccagacgctacatcctgatcctggagcgaccggatccttgccaagatctccagagcttctgtgaggagaacggctgtctggatgagcgtctggccaagaaagtgctggtgcagctgatcgcggccctaaaacactgcgagagccgcggcgtcctgcaccgggacgtcaaaccagaaaacctgctgatctccacagagtcccaggacatcaagctgctggacttcggctgtggagatctgctgaagcgctcggcctacaaatactttgcaggcactcctgcatacgctcctcctgagtggtttcgtagacatcgctaccatgcgactccagctacagtctggtcagtaggagtgacgctctacaacatcctgtgtgaccgtttcccattcagaggcgcacagagggtcacgtccagaagccgactgaccttccctaggagcttgtcaacagagtgccgtcagctgattcgctggtgtctcagtgcagcaccggctgatcggcccagtttagatgacattgagagccatccctggttgcactgcaca

Function

symbol description
pimr22 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000078312

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00023233 True 784 mRNA 0.58 5 46739693 46740881

Neighbor

gene id symbol gene type direction distance location
XLOC_011706 NA coding upstream 275517 46455790 ~ 46464176 (+)
XLOC_011705 si:dkey-206p8.1 coding upstream 300441 46387086 ~ 46439252 (+)
XLOC_011704 NA coding upstream 559456 46172679 ~ 46180237 (+)
XLOC_011703 kif26ab coding upstream 750227 45815353 ~ 45989466 (+)
XLOC_011702 dre-mir-203a coding upstream 931445 45808153 ~ 45808248 (+)
XLOC_011708 NA coding downstream 2415 46743296 ~ 46825416 (+)
XLOC_011709 pimr14 coding downstream 77640 46818521 ~ 46820429 (+)
XLOC_011710 CU137681.6 coding downstream 108368 46849249 ~ 46849346 (+)
XLOC_011711 CU137681.1 coding downstream 110145 46851026 ~ 46854102 (+)
XLOC_011712 pimr27 coding downstream 123235 46864116 ~ 46866095 (+)
XLOC_011691 NA non-coding upstream 1389698 45348023 ~ 45349995 (+)
XLOC_011688 NA non-coding upstream 1539152 45193180 ~ 45200541 (+)
XLOC_011713 CU137681.2 non-coding downstream 171009 46911890 ~ 46920595 (+)
XLOC_011716 NA non-coding downstream 379398 47120279 ~ 47122203 (+)

Expression


Co-expression Network