G362064


Basic Information

Item Value
gene id G362064
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000154
NCBI id null
chromosome length 1600967
location 707653 ~ 707954 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU412896
TAATAATGAGCGCCTCCTCCGCCATGTTGCCGTCAAATAAAACAGTTGTCATGCCAACTTTCTACTGTAAACAGAAGCTCGCAACGCTTGCCCCGCCTCCGAGTTCTTCTGATTGGTCCACTGTTTTGGAACTGACATTGATGAGCGGCGCTGCGTGTAAAAGTTGAAATTCTTTTAACTTGACACAGCATCTTAAAAATGCGGTGCTCATGTGCGAGGCGCTGCAAAAGATGCGAGACGCGAGCGTGACAGTCATGCACGTCCGTCAAGCACGTGTTTACATAGAACAATGGAAAAGTAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU412896 True 302 lncRNA 0.48 1 707653 707954

Neighbor

gene id symbol gene type direction distance location
CI01000154_00594797_00604722 NA coding downstream 102299 594714 ~ 605354 (-)
CI01000154_00563885_00564103 NA coding downstream 143550 563521 ~ 564103 (-)
CI01000154_00028488_00030445 NDUFC2, NDUC2 coding downstream 677208 28370 ~ 30445 (-)
CI01000154_00744348_00748552 SGCG coding upstream 36321 744275 ~ 748552 (-)
CI01000154_00756309_00761576 SLC37A4A, SLC37A4 coding upstream 47875 755829 ~ 762316 (-)
CI01000154_00797516_00828865 PTGIR coding upstream 89447 797401 ~ 828865 (-)
CI01000154_00847380_00859545 NA coding upstream 138828 846782 ~ 861632 (-)
CI01000154_00864988_00870719 PPM1NA coding upstream 157014 864968 ~ 871344 (-)
G362045 NA non-coding downstream 28890 674142 ~ 678763 (-)
G362003 NA non-coding downstream 113206 594233 ~ 594447 (-)
G361977 NA non-coding downstream 114074 593029 ~ 593579 (-)
G361999 NA non-coding downstream 122819 584568 ~ 584834 (-)
G361998 NA non-coding downstream 125138 582016 ~ 582515 (-)
G362082 NA non-coding upstream 78231 786185 ~ 786509 (-)
G362098 NA non-coding upstream 128882 836836 ~ 837043 (-)
G362111 NA non-coding upstream 165466 873420 ~ 873714 (-)
G362116 NA non-coding upstream 170740 878694 ~ 878901 (-)
G362117 NA non-coding upstream 171187 879141 ~ 879413 (-)
CI01000154_01524327_01555571 NA other upstream 823763 1524267 ~ 1555647 (-)

Expression


Co-expression Network