XLOC_011742 (CU655820.1)


Basic Information

Item Value
gene id XLOC_011742
gene name CU655820.1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 50122243 ~ 50190705 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00023286
tagggatgtaacaatattgtaaataccgtcataccgcaatagtaatttttttcaatattgcctaatttttttcaatattgccgtaggcgcatgactcaataaaactatatttctgagaaaagtttgctcaggcgaatgaagcgaacgggaggtagcgggaactacaattcccatcagcctaggcgtggccatcatcctttgcggtctgttgtcactacagatccagtaatgcggaaatggagtgtgttgctagtagcggggaagaaaaagagctggaaatgatcgaacctaaagcgggttttaaatcggatgtgtggaagcatttcagtttctttctaaaaagatacgaaaaaggagaaaaggtgacagacaaagagaaaaacagtatgcaggcactgccagactgtggtgaaatataagtcggggaatacgactaataacagtcatggggactgcagaacacagcacacttgttagattgatgcagacattgacttgtaccttaaagagacctctatctcactcatggcttgtcctctcaagtggtggaaa

Function

GO:

id name namespace
GO:0008033 tRNA processing biological_process
GO:0072686 mitotic spindle cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:0005819 spindle cellular_component
GO:0015630 microtubule cytoskeleton cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0005634 nucleus cellular_component
GO:0043226 organelle cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0004519 endonuclease activity molecular_function
GO:0033204 ribonuclease P RNA binding molecular_function
GO:0015631 tubulin binding molecular_function
GO:0008017 microtubule binding molecular_function
GO:0016893 endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5'-phosphomonoesters molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000097365

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00023286 True 552 lncRNA 0.42 2 50122243 50190705

Neighbor

gene id symbol gene type direction distance location
XLOC_011741 vps39 coding upstream 7971 50074372 ~ 50114272 (+)
XLOC_011740 zgc:113372 coding upstream 479877 49637257 ~ 49642366 (+)
XLOC_011739 CU929037.2 coding upstream 521129 49597112 ~ 49601114 (+)
XLOC_011738 NA coding upstream 568566 49551893 ~ 49553677 (+)
XLOC_011736 AREL1 coding upstream 592198 49484640 ~ 49530045 (+)
XLOC_011744 zc2hc1c coding downstream 57447 50248152 ~ 50259782 (+)
XLOC_011745 syncripl coding downstream 70898 50261603 ~ 50285417 (+)
XLOC_011746 znf982 coding downstream 199118 50389823 ~ 50406181 (+)
XLOC_011747 NA coding downstream 234899 50425604 ~ 50426685 (+)
XLOC_011748 NA coding downstream 251193 50441898 ~ 50478262 (+)
XLOC_011737 LO018408.2 non-coding upstream 611243 49510866 ~ 49511000 (+)
XLOC_011734 NA non-coding upstream 700873 49414820 ~ 49421370 (+)
XLOC_011731 CABZ01088109.1 non-coding upstream 1102592 48964632 ~ 49019651 (+)
XLOC_011753 NA non-coding downstream 601174 50791879 ~ 50794536 (+)
XLOC_011756 NA non-coding downstream 808568 50999273 ~ 51016383 (+)
XLOC_011757 NA non-coding downstream 1009421 51200126 ~ 51203640 (+)

Expression


Co-expression Network