G364272


Basic Information

Item Value
gene id G364272
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000158
NCBI id null
chromosome length 1938735
location 1908962 ~ 1909163 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU415488
GCCCATATAGTATGATTTAGTAAGAATATAGAGGGAAAAAAACATCAATTTTATTCAGAAGCCCAAACTGAGCAAAAATATGCAGTTCAGTGCAGATGATGCTATTTGTATGGCCAAAAAAGTAAGATGAAATTCTGATAGCTTGTAATGTAAATTAGAGAAATCTTTATAACAGTATAGCAGACTACTTAAAACGTTTACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU415488 True 202 lncRNA 0.31 1 1908962 1909163

Neighbor

gene id symbol gene type direction distance location
CI01000158_01808271_01810226 NA coding downstream 98431 1807960 ~ 1810531 (-)
CI01000158_01689842_01690063 NA coding downstream 218899 1689543 ~ 1690063 (-)
CI01000158_01674288_01681153 NA coding downstream 227809 1673678 ~ 1681153 (-)
CI01000158_01641190_01654617 SEPT5, SEPT5B, SEPT5.S coding downstream 254345 1641084 ~ 1654617 (-)
CI01000158_01602975_01638158 MCTP1B coding downstream 270804 1602922 ~ 1638158 (-)
CI01000158_01921098_01929676 TACR1B coding upstream 11429 1920592 ~ 1929676 (-)
G364270 NA non-coding downstream 982 1902595 ~ 1907980 (-)
G364286 NA non-coding downstream 9518 1898948 ~ 1899444 (-)
G364268 NA non-coding downstream 39009 1854611 ~ 1869953 (-)
G364229 NA non-coding downstream 119807 1779210 ~ 1789155 (-)
G364109 NA non-coding downstream 237854 1669390 ~ 1671108 (-)
G364282 NA non-coding upstream 8620 1917783 ~ 1919775 (-)
G364203 NA other downstream 220134 1687966 ~ 1688828 (-)
G364103 NA other downstream 407415 1452257 ~ 1501547 (-)
CI01000158_00717478_00721819 STAMBPA, STAMBP other downstream 1186450 717291 ~ 722084 (-)
CI01000158_00286848_00307666 NA other downstream 1593573 286545 ~ 307666 (-)

Expression


Co-expression Network