Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G373505

Basic Information

Item	Value
gene id	G373505
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000174
NCBI id	null
chromosome length	763745
location	675429 ~ 675631 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU426591
GAAACATGATGCATTAAGAGTCGGGGGGTGAAAACATTTGGAATTTGAAGATCAAGGTAAATTGTATTTAATTTGTCTTCAGGGAAACATGCAAGTATTTTCTGTTGCTTCCGAAGGGCAGTACTAAATGAAAAAAAAATGATATTCAAGCGAAATAAGAAAAATTTGGACATCTGCATCCTGTTCAAAAGTTTTCACCCCCC

Function

GO:

id	name	namespace
GO:0016071	mRNA metabolic process	biological_process
GO:0000375	RNA splicing, via transesterification reactions	biological_process
GO:0000377	RNA splicing, via transesterification reactions with bulged adenosine as nucleophile	biological_process
GO:0006397	mRNA processing	biological_process
GO:0000398	mRNA splicing, via spliceosome	biological_process
GO:0016607	nuclear speck	cellular_component
GO:0005681	spliceosomal complex	cellular_component
GO:0005685	U1 snRNP	cellular_component

KEGG:

id	description
ko03040	Spliceosome

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU426591	True	203	lncRNA	0.35	1	675429	675631

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000174_00666708_00668270	NA	coding	downstream	7088	665906 ~ 668341 (-)
CI01000174_00642752_00643518	NA	coding	downstream	31723	642719 ~ 643706 (-)
CI01000174_00445544_00465033	VAV1	coding	downstream	209875	445238 ~ 465554 (-)
CI01000174_00433771_00444896	NA	coding	downstream	230533	433771 ~ 444896 (-)
CI01000174_00418999_00423108	NA	coding	downstream	252321	418999 ~ 423108 (-)
CI01000174_00685987_00708724	NA	coding	upstream	10226	685857 ~ 708960 (-)
CI01000174_00741688_00755085	NA	coding	upstream	66015	741646 ~ 755085 (-)
G373464	NA	non-coding	downstream	20061	654531 ~ 655368 (-)
G373469	NA	non-coding	downstream	21004	654157 ~ 654425 (-)
G373463	NA	non-coding	downstream	37830	635329 ~ 637599 (-)
G373478	NA	non-coding	downstream	51325	623089 ~ 624104 (-)
G373490	NA	non-coding	downstream	66797	608354 ~ 608632 (-)
G373506	NA	non-coding	upstream	3008	678639 ~ 678901 (-)
G373338	NA	other	downstream	546609	126536 ~ 128820 (-)

Expression

Co-expression Network