G373506


Basic Information

Item Value
gene id G373506
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000174
NCBI id null
chromosome length 763745
location 678639 ~ 678901 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU426592
TGTCTCCTGCAAGAAACGCATTTATCAGAATCAGATTATAACAAAATTAAATCATCAAATTACAGTCATTTATTCTCTGCTCACTACAACACAAAACAAAGAGGAGTATGCATTCTAATAAATAAAAAAATCTCTTTTGTTCATAATACCACCATTACAGACCCTGAAGGACGTTTCATTATCATAAACATCTCCATTAATAATAGCCCAGTCACAATTGGCAACTTATATGGCCCAAACACAGATGACCCATCCTTTTTCCA

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU426592 True 263 lncRNA 0.33 1 678639 678901

Neighbor

gene id symbol gene type direction distance location
CI01000174_00666708_00668270 NA coding downstream 10298 665906 ~ 668341 (-)
CI01000174_00642752_00643518 NA coding downstream 34933 642719 ~ 643706 (-)
CI01000174_00445544_00465033 VAV1 coding downstream 213085 445238 ~ 465554 (-)
CI01000174_00433771_00444896 NA coding downstream 233743 433771 ~ 444896 (-)
CI01000174_00418999_00423108 NA coding downstream 255531 418999 ~ 423108 (-)
CI01000174_00685987_00708724 NA coding upstream 6956 685857 ~ 708960 (-)
CI01000174_00741688_00755085 NA coding upstream 62745 741646 ~ 755085 (-)
G373505 NA non-coding downstream 3008 675429 ~ 675631 (-)
G373464 NA non-coding downstream 23271 654531 ~ 655368 (-)
G373469 NA non-coding downstream 24214 654157 ~ 654425 (-)
G373463 NA non-coding downstream 41040 635329 ~ 637599 (-)
G373478 NA non-coding downstream 54535 623089 ~ 624104 (-)
G373338 NA other downstream 549819 126536 ~ 128820 (-)

Expression


Co-expression Network