CI01000186_00799178_00799351 (RHOA)


Basic Information

Item Value
gene id CI01000186_00799178_00799351
gene name RHOA
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000186
NCBI id null
chromosome length 966831
location 798930 ~ 800937 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000186_00799178_00799351.mRNA
GAGCCCGTCAAACCCGAGGAGGGCCGAGACATGGCCAACCGCATCTGTGCCTTCGGATACATGGAGTGCTCTGCCAAAACCAAGGACGGCGTGCGGGAGGTGTTTGAGATGGCCACCAGGGCGGCGCTGCAGGCCAGGAAGGGCAAAAAGAACAACAAATGCCTGCTGCTGTAAACGGACTGTGTTCATTTTATTCCTTTTAACTGAATCAGTTCATCTAGTGTTGAGAGTTTATGTCAGTATTTAACGCTTCGATTGAATTTGCCACATTCAGACTCGCCGTGAGCCGCAAACACACGAATATGCAACCGATCCGGACCAAGGTGCACTGCACACACTCGGACAGACTTGAAACTCATTCTTTTGTCTTTCACAATAAGCAGAATTTGGTATGTTTGTGTATTAAA

Function

symbol description
rhoa Enables GTP binding activity; GTPase activity; and myosin binding activity. Involved in several processes, including cell surface receptor signaling pathway; cytoskeleton organization; and positive regulation of intracellular signal transduction. Acts upstream of or within several processes, including endothelial tube lumen extension; negative regulation of cell migration involved in sprouting angiogenesis; and positive regulation of stress fiber assembly. Located in several cellular components, including apical junction complex; dendritic spine; and endosome. Is extrinsic component of cytoplasmic side of plasma membrane. Is active in glutamatergic synapse and postsynapse. Colocalizes with cleavage furrow. Implicated in breast carcinoma. Biomarker of breast cancer; colorectal cancer; multiple sclerosis; ovarian carcinoma; and urinary bladder cancer.

GO:

id name namespace
GO:0038027 apolipoprotein A-I-mediated signaling pathway biological_process

KEGG:

id description
K04513 RHOA; Ras homolog gene family, member A

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000186_00799178_00799351.mRNA False 407 mRNA 0.49 1 798945 799351

Neighbor

gene id symbol gene type direction distance location
CI01000186_00777653_00779924 GDI1 coding downstream 16788 776720 ~ 782157 (-)
CI01000186_00768176_00773034 NA coding downstream 25843 767681 ~ 773102 (-)
CI01000186_00763236_00766749 SLC25A20.2, SLC25A20, SLC25A20.L, SLC25A20.2.S coding downstream 32196 763082 ~ 766749 (-)
CI01000186_00749734_00761177 PRKAR2A, SLC25A20, PRKAR2AB coding downstream 37768 749543 ~ 761177 (-)
CI01000186_00723511_00725818 NA coding downstream 73024 723145 ~ 725921 (-)
CI01000186_00804745_00805695 ORA1 coding upstream 5293 804644 ~ 805753 (-)
CI01000186_00815815_00829935 MMYHEMB1, MMYHL2, MMYHL1 coding upstream 16381 815732 ~ 831302 (-)
CI01000186_00842940_00858572 MYHZ1.1 coding upstream 42926 842277 ~ 858696 (-)
CI01000186_00873286_00934953 MMYHEMB1, MYHB, MYHM86-1 coding upstream 73780 873131 ~ 934953 (-)
CI01000186_00956103_00957823 NA coding upstream 156752 956103 ~ 957823 (-)
G378631 NA non-coding downstream 38731 759893 ~ 760214 (-)
G378623 NA non-coding downstream 56878 741788 ~ 742067 (-)
G378622 NA non-coding downstream 60322 738340 ~ 738623 (-)
G378616 NA non-coding downstream 71029 727696 ~ 727916 (-)
G378634 NA non-coding upstream 8820 808171 ~ 808400 (-)
G378670 NA non-coding upstream 142938 942289 ~ 946294 (-)
CI01000186_00485805_00522951 CELSR2 other downstream 310462 485796 ~ 523767 (-)
G378509 NA other downstream 402190 396258 ~ 396755 (-)
CI01000186_00360860_00361637 NA other downstream 431954 360640 ~ 366991 (-)
CI01000186_00240507_00248051 DENND2DB other downstream 550861 240329 ~ 248084 (-)
CI01000186_00215443_00223579 STK38, STK38A, STK38B other downstream 575181 215399 ~ 223764 (-)

Expression


Co-expression Network