G378128


Basic Information

Item Value
gene id G378128
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000186
NCBI id null
chromosome length 966831
location 15491 ~ 15968 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU432181
TAATTTTGCTACATTTTCCTTGAATACTTGAAGAATATGGCACTTTTTTTTGTTATTTTGCTGTATCCCACATGAAAAAAACTACAGTAATTTATAGTAAATACTATAGTGCTTTTGAGCCATACTAGAGTAAAATACTTTGATTATTTTGTTGTGGTAATTCTATAGTTGCCGTGGTAATATAACAACTATAGTAATATAAACAAATTACTTTACCCAATACTGTAATACGTTTTCTACAACTATAGGATACATTATACTACAATACACTACAGTTTACTGTAGTAAAACTAAAGTATACTACAGTATTTATTACAGTTTATCAATTCACTATACTTAATACTACAGTATGCTGTAGCATTCATTAACAGAGTGTTGTAAATATTATAATATATACACAGTATACTACAATTTTAGTGCACTCAATTTTTGTGATATCAACTATAAATTTGGAAGACAACTTTGTTAGACATATGAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU432181 True 478 lncRNA 0.26 1 15491 15968

Neighbor

gene id symbol gene type direction distance location
CI01000186_00000433_00010367 LONP1 coding upstream 4798 433 ~ 10693 (+)
CI01000186_00016608_00025920 LMNB2 coding downstream 640 16608 ~ 26754 (+)
CI01000186_00091411_00095100 ING5, ING5A coding downstream 75011 90979 ~ 95538 (+)
CI01000186_00098106_00099994 NA coding downstream 81208 97176 ~ 100163 (+)
CI01000186_00102313_00108968 PAK2 coding downstream 86144 102112 ~ 109867 (+)
CI01000186_00111894_00116331 NA coding downstream 95926 111894 ~ 116838 (+)
G378108 NA non-coding upstream 262 11415 ~ 15229 (+)
G378130 NA non-coding downstream 13528 29496 ~ 29721 (+)
G378131 NA non-coding downstream 14508 30476 ~ 31024 (+)
G378134 NA non-coding downstream 17990 33958 ~ 34226 (+)
G378136 NA non-coding downstream 19473 35441 ~ 35705 (+)
G378137 NA non-coding downstream 20474 36442 ~ 36675 (+)
CI01000186_00413028_00415878 SFRS3, SRSF3 other downstream 395852 412601 ~ 416323 (+)
G378343 NA other downstream 878540 881526 ~ 896717 (+)

Expression


Co-expression Network