Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G378418

Basic Information

Item	Value
gene id	G378418
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000186
NCBI id	null
chromosome length	966831
location	53467 ~ 53684 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU432578
TCTTGGCCTCCAAATTCCCCAGATCTCAATCCAATCGAGCATCTGTGGGATGTGCTGAACAAACAAGTCTGATCCATGGAGGCTCCACCTCACAACTTACAGGACTTAAAGGATCTGCTGCTAACATCTTGGTGCAGATACCACAGCACACCTTCAGGGGTCTAGAGGAGTCCATGCCTCGACGGGTCAGGGCTGTTTTGGCAGCAAAAGAGGGACCA

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU432578	True	218	lncRNA	0.51	1	53467	53684

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000186_00039365_00051758	HRH4	coding	downstream	981	39303 ~ 52486 (-)
CI01000186_00011522_00015307	RPL36, RPL36-PS3, RPL36-PS8, GM13611	coding	downstream	38160	11500 ~ 15307 (-)
CI01000186_00087531_00090364	NA	coding	upstream	33809	87493 ~ 90491 (-)
CI01000186_00095947_00097088	CEP19	coding	upstream	41961	95645 ~ 97142 (-)
CI01000186_00144110_00151887	CAMK1GA	coding	upstream	89978	143662 ~ 151887 (-)
CI01000186_00156270_00161766	NA	coding	upstream	102499	156183 ~ 161766 (-)
CI01000186_00165206_00167364	PPARDB, PPARD, PPARB, PPARDA	coding	upstream	111358	165042 ~ 167459 (-)
G378444	NA	non-coding	downstream	22481	30676 ~ 30986 (-)
G378453	NA	non-coding	upstream	57608	111292 ~ 111496 (-)
G378454	NA	non-coding	upstream	58980	112664 ~ 112887 (-)
G378455	NA	non-coding	upstream	60684	114368 ~ 116870 (-)
G378457	NA	non-coding	upstream	64112	117796 ~ 118319 (-)
G378456	NA	non-coding	upstream	66057	119741 ~ 120168 (-)
G378458	NA	other	upstream	66998	120682 ~ 121425 (-)
G378466	NA	other	upstream	138486	192170 ~ 193760 (-)
CI01000186_00215443_00223579	STK38, STK38A, STK38B	other	upstream	163792	215399 ~ 223764 (-)
CI01000186_00240507_00248051	DENND2DB	other	upstream	191689	240329 ~ 248084 (-)
CI01000186_00360860_00361637	NA	other	upstream	307226	360640 ~ 366991 (-)

Expression

Co-expression Network