G378458


Basic Information

Item Value
gene id G378458
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000186
NCBI id null
chromosome length 966831
location 120682 ~ 121425 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU432622
GAGGGTCAAACTCAGAGGATTCACGCACATCAGATGAACAGCTCGGTTGTTTTCAGCGGATTAGATCATTTTTACTGAAGAAAATGTTTCAAATGCTTGTTTTGTTCTGTTTGTGCTGGCGGCGACTGATCTGTGTGTTTGGTGCTGAAACAAATGAAATACAGTCAGTGTCAGTGATGGAGGGAGATTCTGTGCTTCTTCACACTGATATTACTGAACCACATAAACATGATGACATACTGTGGAAATTTGGAGCTGAAAAGTCTCTCATAGCTAAAATCAACAGGGAGGCAGGAATCTTCTCCACATATGATGTTCCTGATGGGAGATTCAGAGACAGACTGAAGCTGGATGATCAAACTGGATCTCTGACCATCACAAACATCACAACTGAACATGCTGGACTCTATGAAGTAAAGATAATCGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU432622 True 427 TUCP 0.42 2 120682 121425

Neighbor

gene id symbol gene type direction distance location
CI01000186_00095947_00097088 CEP19 coding downstream 23540 95645 ~ 97142 (-)
CI01000186_00087531_00090364 NA coding downstream 30191 87493 ~ 90491 (-)
CI01000186_00039365_00051758 HRH4 coding downstream 68196 39303 ~ 52486 (-)
CI01000186_00011522_00015307 RPL36, RPL36-PS3, RPL36-PS8, GM13611 coding downstream 105375 11500 ~ 15307 (-)
CI01000186_00144110_00151887 CAMK1GA coding upstream 22237 143662 ~ 151887 (-)
CI01000186_00156270_00161766 NA coding upstream 34758 156183 ~ 161766 (-)
CI01000186_00165206_00167364 PPARDB, PPARD, PPARB, PPARDA coding upstream 43617 165042 ~ 167459 (-)
CI01000186_00175457_00185420 NA coding upstream 53774 175199 ~ 185420 (-)
CI01000186_00215443_00223579 STK38, STK38A, STK38B coding upstream 93974 215399 ~ 223764 (-)
G378456 NA non-coding downstream 514 119741 ~ 120168 (-)
G378457 NA non-coding downstream 2363 117796 ~ 118319 (-)
G378455 NA non-coding downstream 3812 114368 ~ 116870 (-)
G378454 NA non-coding downstream 7795 112664 ~ 112887 (-)
G378453 NA non-coding downstream 9186 111292 ~ 111496 (-)
G378476 NA non-coding upstream 94357 215782 ~ 216043 (-)
G378399 NA non-coding upstream 115713 240855 ~ 241071 (-)
G378480 NA non-coding upstream 179461 300886 ~ 301234 (-)
G378481 NA non-coding upstream 180786 302211 ~ 302489 (-)
G378482 NA non-coding upstream 201104 322529 ~ 322781 (-)
G378466 NA other upstream 70745 192170 ~ 193760 (-)
CI01000186_00240507_00248051 DENND2DB other upstream 123948 240329 ~ 248084 (-)
CI01000186_00360860_00361637 NA other upstream 239485 360640 ~ 366991 (-)
G378509 NA other upstream 274833 396258 ~ 396755 (-)

Expression


Co-expression Network