G378213


Basic Information

Item Value
gene id G378213
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000186
NCBI id null
chromosome length 966831
location 317330 ~ 317532 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU432303
GTTTATTCACTCAAATATATATATATAAATATTGTATTTTTGGGGATAAAAACAGGCGAACGTGCCGCTGTAAATGTTCAAATAGAGGTTTAAATAACTCCTTAAACTTACCAAACCTTGACCTGACTAAATATTAACTCAAAACAGCAGATTTTTATCAAACTCTAAAAAGCACTTACAGCACGGCAGGAATTAATAGACAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU432303 True 203 lncRNA 0.32 1 317330 317532

Neighbor

gene id symbol gene type direction distance location
CI01000186_00295882_00296578 BTG2 coding upstream 20379 295669 ~ 296951 (+)
CI01000186_00272056_00278805 RBBP5 coding upstream 38153 271668 ~ 279177 (+)
CI01000186_00252556_00256882 NA coding upstream 60061 252556 ~ 257269 (+)
CI01000186_00235234_00237816 DRAM2, DRAM2B coding upstream 79209 234897 ~ 238121 (+)
CI01000186_00225560_00231307 CEPT1, CEPT1B coding upstream 85760 225560 ~ 231570 (+)
CI01000186_00402892_00406010 APOBEC2A coding downstream 85360 402892 ~ 406133 (+)
CI01000186_00413028_00415878 SFRS3, SRSF3 coding downstream 95069 412601 ~ 416323 (+)
CI01000186_00420359_00420723 NA coding downstream 102827 420359 ~ 421445 (+)
CI01000186_00422121_00422913 NA coding downstream 104550 422082 ~ 424110 (+)
CI01000186_00427652_00430661 TMCC2 coding downstream 110120 427652 ~ 431316 (+)
G378204 NA non-coding upstream 69156 245430 ~ 248174 (+)
G378117 NA non-coding upstream 151883 162974 ~ 165447 (+)
G378187 NA non-coding upstream 158754 158339 ~ 158576 (+)
G378184 NA non-coding upstream 164057 153065 ~ 153273 (+)
G378148 NA non-coding upstream 263567 53350 ~ 53763 (+)
G378208 NA non-coding downstream 630 318162 ~ 320122 (+)
G378300 NA non-coding downstream 171270 488802 ~ 492677 (+)
G378322 NA non-coding downstream 248464 565996 ~ 566341 (+)
CI01000186_00567272_00571417 NA non-coding downstream 249430 566929 ~ 571768 (+)
G378325 NA non-coding downstream 319486 637018 ~ 637549 (+)
G378108 NA other upstream 303835 11415 ~ 15229 (+)
G378343 NA other downstream 576976 881526 ~ 896717 (+)

Expression


Co-expression Network