G385722



Basic Information


Item Value
gene id G385722
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000195
NCBI id null
chromosome length 1404554
location 680705 ~ 683279 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU441285
CGCAAATGTTTGCGAAGCAGTGCTTCTCTCTCTCGCCCCAGCGATGCCGGAGTTGGGACAGCCAAAGAAAGGCCTGAGAGTTCTCCACCTTTTGCTTATTGATTTTGTCCACCACGTCTCTCGCATGGACGTCAATGGTACAGATGGTCATGACTTTCTGCCGGTCTCCAGGAGTGAGCTGGCCAATCAGCATGGTGATGAGGGTGTTTAACTGATTCACTTGCTTTTTATAGTATTCCTTCATTGCATTCTCATTTCCATCCTCCAGTCCAGAGAACGCAATACCTACATCGGTCGTCCACCAGATCTGAGTGCAAGTAAGAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU441285 True 324 lncRNA 0.49 2 680705 683279

Neighbor


gene id symbol gene type direction distance location
CI01000195_00540011_00558639 NA coding downstream 122066 539412 ~ 558639 (-)
CI01000195_00473436_00498770 PLEKHG3 coding downstream 181935 473382 ~ 498770 (-)
CI01000195_00375179_00378443 NA coding downstream 302262 374199 ~ 378443 (-)
CI01000195_00286609_00287289 NA coding downstream 393390 286367 ~ 287315 (-)
CI01000195_00277321_00278413 NA coding downstream 401967 276874 ~ 278738 (-)
CI01000195_00781053_00802555 CEBPZ coding upstream 97579 780858 ~ 802555 (-)
CI01000195_00823303_00824935 MARCKS coding upstream 139650 822929 ~ 825488 (-)
CI01000195_00947211_00947449 NA coding upstream 263724 947003 ~ 947449 (-)
CI01000195_00959548_00967537 NA coding upstream 275158 958437 ~ 967751 (-)
CI01000195_00972854_00976498 NA coding upstream 289069 972348 ~ 976713 (-)
G385709 NA non-coding downstream 34942 645237 ~ 645763 (-)
G385672 NA non-coding downstream 59323 620228 ~ 621382 (-)
G385617 NA non-coding downstream 213349 456033 ~ 467356 (-)
G385656 NA non-coding downstream 260862 419085 ~ 419843 (-)
G385632 NA non-coding downstream 292470 385992 ~ 388235 (-)
G385730 NA non-coding upstream 19060 702339 ~ 704200 (-)
G385609 NA non-coding upstream 230262 913541 ~ 915824 (-)
G385608 NA non-coding upstream 284057 967336 ~ 967390 (-)
G385854 NA non-coding upstream 377282 1060561 ~ 1061208 (-)
G385070 NA other downstream 583186 97058 ~ 97519 (-)
G385869 NA other upstream 517077 1200356 ~ 1209651 (-)

Expression



Co-expression Network