G394366


Basic Information

Item Value
gene id G394366
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000222
NCBI id null
chromosome length 845821
location 241609 ~ 251264 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU451744
CAAACAACAGAACGACACAACCGAACAGACTGGAAGCATGCAAGCTACAGAGACAATGAAGGCCTACATAGATGAGAGACTGTGCAAAGAGGGTCATAGGGCTGGAGCTTATCTCAGTTTCTTTGGGCCAAAGGCAAGGGAAAGCAGCACCCTGGCCTGGACAGATGTCCAGTCCATCACAGGGCTCTCTCACACACACAAAGGCAATTTTTAACTCTTCAATTCACCTAACCTGCATGTCTTTGGACTGTGGGGGAAACCGGAGTACCCGGAGGAAGATCACACTCAAATCAACATCAAATTCTCCAAAGCTGTTCACCAAGCTTACGATTAAATTTCATATTTGAAATCACCAATGAAATCTGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU451744 True 366 lncRNA 0.46 3 241609 251264

Neighbor

gene id symbol gene type direction distance location
CI01000222_00232414_00239331 NA coding upstream 2199 232198 ~ 239410 (+)
CI01000222_00214433_00217905 NA coding upstream 23690 214433 ~ 217919 (+)
CI01000222_00200608_00202045 NA coding upstream 39472 200608 ~ 202137 (+)
CI01000222_00167369_00168395 NA coding upstream 72857 166197 ~ 168752 (+)
CI01000222_00255680_00256841 NA coding downstream 4348 255612 ~ 256846 (+)
CI01000222_00315211_00317790 NA coding downstream 63947 315211 ~ 318086 (+)
CI01000222_00328639_00330158 NA coding downstream 77375 328639 ~ 330374 (+)
CI01000222_00531504_00560379 NA coding downstream 279891 531155 ~ 560714 (+)
CI01000222_00584243_00585193 NA coding downstream 332737 584001 ~ 585218 (+)
G394362 NA non-coding upstream 38720 202577 ~ 202889 (+)
G394348 NA non-coding upstream 47935 193458 ~ 193674 (+)
G394297 NA non-coding upstream 83430 134534 ~ 158179 (+)
G394293 NA non-coding upstream 129486 109188 ~ 112123 (+)
G394394 NA non-coding downstream 17680 268944 ~ 269180 (+)
G394395 NA non-coding downstream 18906 270170 ~ 270521 (+)
G394352 NA non-coding downstream 32734 283998 ~ 287078 (+)
G394396 NA non-coding downstream 36744 288008 ~ 288342 (+)
G394400 NA non-coding downstream 46624 297888 ~ 298123 (+)
G394294 NA other upstream 92699 132044 ~ 148910 (+)
G394303 NA other upstream 198762 31433 ~ 42847 (+)
G394482 NA other downstream 210725 461989 ~ 462466 (+)
G394559 NA other downstream 499083 750347 ~ 752670 (+)

Expression


Co-expression Network