G395142


Basic Information

Item Value
gene id G395142
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000225
NCBI id null
chromosome length 750214
location 220464 ~ 234314 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU452731
CAGGGTAATGTGTGCGTTCAAAAGCTCTCTCCAGCTCCTCCAGCTGTTCGGCCGTGAATGTTGTTCGACTGCGCCGCTGTTTCCTTTTCAGCGGCAGATCGGGCTCAGATTCCACGTCTGAACCTTCATCAGAAGGACTCGATCTTTCTGCTAGAATCCCATCGATACTGTGTCCGCTCCTGCGGGCGTGTTCTTCCTGCTCGCGCTTTTCGATGTCCTCTTCATCCTCCTCCTCGTCTTCTTCCTCCTCCTCGTCACCTCTCGCGCCGTTTTTGCCTCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU452731 True 281 lncRNA 0.55 2 220464 234314

Neighbor

gene id symbol gene type direction distance location
CI01000225_00195825_00204991 SGPP2 coding downstream 15473 195709 ~ 204991 (-)
CI01000225_00166452_00178904 NA coding downstream 41560 164269 ~ 178904 (-)
CI01000225_00111148_00126263 NA coding downstream 92677 110001 ~ 128097 (-)
CI01000225_00052354_00104366 TIAM1B, TIAM1 coding downstream 114313 52092 ~ 106151 (-)
CI01000225_00044417_00045162 NA coding downstream 175302 44255 ~ 45162 (-)
CI01000225_00383340_00392393 NA coding upstream 148773 383087 ~ 392393 (-)
CI01000225_00393863_00402338 NA coding upstream 159549 393863 ~ 402538 (-)
CI01000225_00404519_00407448 NA coding upstream 170061 404375 ~ 408629 (-)
CI01000225_00425270_00431446 PXYLP1 coding upstream 190285 424599 ~ 431446 (-)
CI01000225_00553926_00616121 NA coding upstream 319612 553926 ~ 616121 (-)
G395123 NA non-coding downstream 25904 193310 ~ 194560 (-)
G395114 NA non-coding downstream 33262 186842 ~ 187202 (-)
G395150 NA non-coding upstream 14907 249221 ~ 249430 (-)
G395330 NA non-coding upstream 179429 413743 ~ 414066 (-)
G395333 NA non-coding upstream 181988 416302 ~ 416743 (-)
G395335 NA non-coding upstream 184000 418314 ~ 418574 (-)
G395314 NA non-coding upstream 185040 419354 ~ 419651 (-)

Expression


Co-expression Network