G405619



Basic Information


Item Value
gene id G405619
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 3321195 ~ 3321433 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU466112
CTGCTCTTGACTGAATAACTTTAGTAGCTCTAATAAGAATACAGTTCTGACTTGAATGCTGCTGTTAAATGCTCTAGTGAGGAGATAAACATGGCGGACTGTGTACAGCTCACTCAGGGGAGGAGCTAAGCTAATAGGGCGGAGTCTGTAATGCAATCATGGGCGGGGCCTGAGGAATGCGATGTCACATTGCATAGAAACTGCAAACGGCTTATTCTGAGACACTGCTTATGATTTAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU466112 True 239 lncRNA 0.44 1 3321195 3321433

Neighbor


gene id symbol gene type direction distance location
CI01000299_03268500_03312490 HECW2 coding upstream 7867 3268193 ~ 3313328 (+)
CI01000299_03267154_03267336 NA coding upstream 53804 3267154 ~ 3267391 (+)
CI01000299_03237334_03244737 GTF3C3 coding upstream 76380 3237334 ~ 3244815 (+)
CI01000299_03215678_03230586 NA coding upstream 90609 3215678 ~ 3230586 (+)
CI01000299_03189537_03200831 FAM134A coding upstream 119789 3189319 ~ 3201406 (+)
CI01000299_03366963_03373293 NA coding downstream 45385 3366818 ~ 3373682 (+)
CI01000299_03382616_03423028 NA coding downstream 61058 3382491 ~ 3423697 (+)
CI01000299_03453437_03453736 NA coding downstream 130867 3452300 ~ 3454209 (+)
CI01000299_03478949_03486009 NA coding downstream 154655 3476088 ~ 3486009 (+)
CI01000299_03495286_03498691 NA coding downstream 173106 3494539 ~ 3498729 (+)
G405618 NA non-coding upstream 183 3320524 ~ 3321012 (+)
G405611 NA non-coding upstream 111784 3208926 ~ 3209411 (+)
G405407 NA non-coding upstream 510523 2810452 ~ 2810672 (+)
G405390 NA non-coding upstream 590686 2730273 ~ 2730509 (+)
G405385 NA non-coding upstream 599871 2720862 ~ 2721324 (+)
G405621 NA non-coding downstream 12794 3334227 ~ 3335205 (+)
G405660 NA non-coding downstream 85152 3406585 ~ 3406810 (+)
G405663 NA non-coding downstream 89101 3410534 ~ 3410764 (+)
G405690 NA non-coding downstream 140945 3462378 ~ 3462582 (+)
G405693 NA non-coding downstream 146085 3467518 ~ 3467780 (+)
G405609 NA other upstream 166021 3154597 ~ 3155174 (+)
G403972 NA other upstream 2714845 604870 ~ 606350 (+)
G403609 NA other upstream 2910407 364139 ~ 410788 (+)
G403578 NA other upstream 3248924 35462 ~ 72271 (+)
CI01000299_04131136_04133439 PCNP other downstream 809825 4131060 ~ 4133941 (+)
G405842 NA other downstream 974100 4295533 ~ 4320141 (+)
CI01000299_04480751_04492829 NA other downstream 1168385 4480553 ~ 4493116 (+)
CI01000299_04703290_04704365 NA other downstream 1380949 4703071 ~ 4704780 (+)
G406096 NA other downstream 1603029 4924462 ~ 4927844 (+)

Expression



Co-expression Network