G405966



Basic Information


Item Value
gene id G405966
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 4671215 ~ 4671482 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU466489
GTTCGATGGCACAAATGTGTAAATAAATAAGAAATAACCACGGAGTGTCTTTAAAAACCCTCTTTTGTGAGGAACTACTTCCTTCCGCCACGGATTCAAATCTCAAGCTGACAGTTTAACAGTTGAGCCCAAGATCCGTTACTAATTCTAAAACGTCACTATAGAACTAGTAACGAAGGAACGTTGAGTTGTTTCATTGAAACTCATTGTAATATGTAGAGTATTATGAAAGAGCGAGTGTATTACCTGCATCTAGCTGATATTCTTC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU466489 True 268 lncRNA 0.37 1 4671215 4671482

Neighbor


gene id symbol gene type direction distance location
CI01000299_04554181_04557794 NA coding upstream 113375 4554111 ~ 4557840 (+)
CI01000299_04532498_04539703 NA coding upstream 131296 4532098 ~ 4539919 (+)
CI01000299_04513358_04524537 NA coding upstream 144538 4513358 ~ 4526677 (+)
CI01000299_04496757_04504238 NA coding upstream 166732 4496386 ~ 4504483 (+)
CI01000299_04480751_04492829 NA coding upstream 178099 4480553 ~ 4493116 (+)
CI01000299_04703290_04704365 NA coding downstream 31589 4703071 ~ 4704780 (+)
CI01000299_04736806_04740333 CLIC6 coding downstream 65324 4736806 ~ 4740975 (+)
CI01000299_04819297_04829755 NA coding downstream 147203 4818685 ~ 4829987 (+)
CI01000299_04864582_04885052 RUNX1 coding downstream 192710 4864192 ~ 4885385 (+)
CI01000299_04892566_04900169 NA coding downstream 218909 4890391 ~ 4900536 (+)
G405865 NA non-coding upstream 6171 4649936 ~ 4665044 (+)
G405881 NA non-coding upstream 7820 4658341 ~ 4663395 (+)
G405938 NA non-coding upstream 120416 4475988 ~ 4550799 (+)
G405932 NA non-coding upstream 215530 4455446 ~ 4455685 (+)
G405967 NA non-coding downstream 43 4671525 ~ 4671895 (+)
G406023 NA non-coding downstream 19413 4690895 ~ 4766223 (+)
G405994 NA non-coding downstream 147006 4818488 ~ 4933935 (+)
CI01000299_04906697_04907091 NA non-coding downstream 238435 4906697 ~ 4910073 (+)
G405842 NA other upstream 351074 4295533 ~ 4320141 (+)
CI01000299_04131136_04133439 PCNP other upstream 537274 4131060 ~ 4133941 (+)
G405609 NA other upstream 1516041 3154597 ~ 3155174 (+)
G403972 NA other upstream 4064865 604870 ~ 606350 (+)
G406096 NA other downstream 252980 4924462 ~ 4927844 (+)
G406244 NA other downstream 699699 5371181 ~ 5373579 (+)
G406161 NA other downstream 1566356 6237838 ~ 6300508 (+)

Expression



Co-expression Network