G408505


Basic Information

Item Value
gene id G408505
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 1235002 ~ 1235214 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU469417
TGGAGCCAGGTGGCTGCACACTCTAGTATGGGAACCCGACACATGGCTATCGCCATAGAAACTAGCTTTCCAAGCATGGCCATGCGGCTCTCATCAGCCTTGTTGCCTTGGAGACTGAAGAGGGCGGAGAAAATGATCTGTCGGATTGCGTCTTTGCTCTGCTCCTGGAAGTAACTGCACATGATCTCCAGCAGCTGCAGTTCTTGAACGCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU469417 True 213 lncRNA 0.53 1 1235002 1235214

Neighbor

gene id symbol gene type direction distance location
CI01000300_01225430_01228695 PMM2 coding upstream 6015 1225430 ~ 1228987 (+)
CI01000300_01128973_01131417 ELFN1B coding upstream 103561 1128812 ~ 1131441 (+)
CI01000300_01115718_01128729 NA coding upstream 106242 1114798 ~ 1128760 (+)
CI01000300_00864011_00867698 UNCX4.1, UNCX coding upstream 366231 862740 ~ 868771 (+)
CI01000300_00807040_00826385 CHTF18 coding upstream 408567 806846 ~ 826435 (+)
CI01000300_01241607_01253459 RGS11 coding downstream 6393 1241607 ~ 1254009 (+)
CI01000300_01272675_01273342 NA coding downstream 37461 1272675 ~ 1273753 (+)
CI01000300_01275725_01282289 NA coding downstream 40151 1275365 ~ 1282428 (+)
CI01000300_01303949_01305865 NA coding downstream 66693 1301907 ~ 1306339 (+)
CI01000300_01331788_01335474 NA coding downstream 95145 1330359 ~ 1335569 (+)
G408504 NA non-coding upstream 2124 1232585 ~ 1232878 (+)
G408507 NA non-coding upstream 2517 1232284 ~ 1232485 (+)
G408503 NA non-coding upstream 84654 1149802 ~ 1150348 (+)
G408508 NA non-coding upstream 87015 1147620 ~ 1147987 (+)
G408533 NA non-coding upstream 88648 1146132 ~ 1146354 (+)
G408585 NA non-coding downstream 8905 1244119 ~ 1244349 (+)
G408586 NA non-coding downstream 14766 1249980 ~ 1250183 (+)
G408587 NA non-coding downstream 16890 1252104 ~ 1252469 (+)
G408588 NA non-coding downstream 19562 1254776 ~ 1254976 (+)
G408607 NA non-coding downstream 56602 1291816 ~ 1292458 (+)
G408498 NA other upstream 214268 1017067 ~ 1020734 (+)
G408510 NA other upstream 257903 976600 ~ 977099 (+)
G408910 NA other downstream 397816 1633030 ~ 1634969 (+)
CI01000300_01753916_01754815 NA other downstream 514686 1753916 ~ 1754980 (+)
CI01000300_02313596_02320912 NA other downstream 1078195 2312515 ~ 2321088 (+)
G409984 NA other downstream 2036471 3271685 ~ 3272398 (+)
CI01000300_03901275_03902800 NA other downstream 2665974 3901148 ~ 3902892 (+)

Expression


Co-expression Network