G408634


Basic Information

Item Value
gene id G408634
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 1462155 ~ 1462416 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU469548
GGTTCTACCACACGTACATTTACTTACGTTTTCATACACACAAAAACGTACAACATTGACGTATTTATAGCACTAAAACGTAAAAATACTTACGTATTAACAGCAAAAAAAACGTAAATCATGTAACGTAAAGTGTGAATGTATATGAATTCCCATGTATTAATATTAAAATCGTGGCTTTAATGATTTAACGATGTTTTTAGTCGAATTTATTGAAAGCAGTTTACTCATCTACTTAATATGAAATAACAGTTCTGTTCGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU469548 True 262 lncRNA 0.29 1 1462155 1462416

Neighbor

gene id symbol gene type direction distance location
CI01000300_01426499_01431069 RBM46 coding upstream 30891 1426053 ~ 1431264 (+)
CI01000300_01419087_01421103 LRATB coding upstream 40823 1419087 ~ 1421332 (+)
CI01000300_01390134_01416227 LRATB coding upstream 45442 1389724 ~ 1416713 (+)
CI01000300_01373306_01377544 FGB coding upstream 84507 1373220 ~ 1377648 (+)
CI01000300_01343814_01353541 TRIM2, TRIM2B coding upstream 106766 1343814 ~ 1355389 (+)
CI01000300_01480400_01484276 NPY2RL coding downstream 17418 1479834 ~ 1484713 (+)
CI01000300_01513060_01515885 EIF3F coding downstream 50489 1512905 ~ 1515885 (+)
CI01000300_01519715_01526925 NA coding downstream 57163 1519579 ~ 1527151 (+)
CI01000300_01527830_01531871 NA coding downstream 65414 1527830 ~ 1532019 (+)
CI01000300_01571005_01611574 DACHB coding downstream 107196 1569612 ~ 1611574 (+)
G408628 NA non-coding upstream 19271 1442624 ~ 1442884 (+)
G408620 NA non-coding upstream 81320 1380562 ~ 1380835 (+)
G408614 NA non-coding upstream 126128 1335804 ~ 1336027 (+)
G408609 NA non-coding upstream 136704 1324862 ~ 1325451 (+)
G408607 NA non-coding upstream 169697 1291816 ~ 1292458 (+)
G408851 NA non-coding downstream 24418 1486834 ~ 1487716 (+)
G408888 NA non-coding downstream 60434 1522850 ~ 1523234 (+)
G408887 NA non-coding downstream 71894 1534310 ~ 1538291 (+)
G408890 NA non-coding downstream 80490 1542906 ~ 1543240 (+)
G408891 NA non-coding downstream 81491 1543907 ~ 1545272 (+)
G408498 NA other upstream 441421 1017067 ~ 1020734 (+)
G408510 NA other upstream 485056 976600 ~ 977099 (+)
G408910 NA other downstream 170614 1633030 ~ 1634969 (+)
CI01000300_01753916_01754815 NA other downstream 287484 1753916 ~ 1754980 (+)
CI01000300_02313596_02320912 NA other downstream 850993 2312515 ~ 2321088 (+)
G409984 NA other downstream 1809269 3271685 ~ 3272398 (+)
CI01000300_03901275_03902800 NA other downstream 2438772 3901148 ~ 3902892 (+)

Expression


Co-expression Network