G408894


Basic Information

Item Value
gene id G408894
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 1546837 ~ 1550388 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU469819
GAGCAAATGATGACAACATGCTTTATTTTTGGGTGAACTATTCCTTTAAGGGCTAGACTCTGTTTATGATAAAACTGTTATTGACATCATTGACAGGTCAAAGGACTCACATAGCTGCCAGTATGGTGACGGAACTCTAGGCCAAAGTACTCCTTCTCTAGCAGCTTTAGATGACCACACACCTTATTGAAGAAATCAGAACCCAGAATCTTTCTCTGCTCCACCTCGAAAACTCTCTCACTGTCGTCTAAGAAGATGACGCGTAATCGCAGTTTCTCATTCTTGTTCTTCTTCCGCGCAGCTGTCCTATTGACAGGTGTCTTCAGCAACTCGAACTTATCCCCCATCTTCTGCGCCTTTAGGGTTTAAACACCACACTTTTCATATAAATAAAGGTTGATAATGTGGGACATTATCCGTTTGATGCTGTTGTGAGGGAGTTGCGCGCGGCGGTCTCGTGACGACTGTTCACGCATCCTGTTTTTAAACTGAGCAGCATCAGCAGCACTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU469819 True 511 lncRNA 0.44 2 1546837 1550388

Neighbor

gene id symbol gene type direction distance location
CI01000300_01527830_01531871 NA coding upstream 14818 1527830 ~ 1532019 (+)
CI01000300_01519715_01526925 NA coding upstream 19686 1519579 ~ 1527151 (+)
CI01000300_01513060_01515885 EIF3F coding upstream 30952 1512905 ~ 1515885 (+)
CI01000300_01480400_01484276 NPY2RL coding upstream 62124 1479834 ~ 1484713 (+)
CI01000300_01426499_01431069 RBM46 coding upstream 115573 1426053 ~ 1431264 (+)
CI01000300_01571005_01611574 DACHB coding downstream 19224 1569612 ~ 1611574 (+)
CI01000300_01753916_01754815 NA coding downstream 203528 1753916 ~ 1754980 (+)
CI01000300_01772239_01783579 ATP1B1B, ATP1B1 coding downstream 221396 1771784 ~ 1783801 (+)
CI01000300_01801423_01807504 CNGA3 coding downstream 251035 1801423 ~ 1808125 (+)
CI01000300_01976057_01980856 NA coding downstream 425669 1976057 ~ 1981187 (+)
G408893 NA non-coding upstream 599 1545968 ~ 1546238 (+)
G408892 NA non-coding upstream 992 1545319 ~ 1545845 (+)
G408891 NA non-coding upstream 1565 1543907 ~ 1545272 (+)
G408890 NA non-coding upstream 3597 1542906 ~ 1543240 (+)
G408887 NA non-coding upstream 8546 1534310 ~ 1538291 (+)
G408909 NA non-coding downstream 82065 1632453 ~ 1632883 (+)
G408942 NA non-coding downstream 133879 1684267 ~ 1684594 (+)
G408934 NA non-coding downstream 175036 1725424 ~ 1730427 (+)
G408929 NA non-coding downstream 185110 1735498 ~ 1744773 (+)
G408976 NA non-coding downstream 236106 1786494 ~ 1786724 (+)
G408498 NA other upstream 526103 1017067 ~ 1020734 (+)
G408510 NA other upstream 569738 976600 ~ 977099 (+)
G408910 NA other downstream 82642 1633030 ~ 1634969 (+)
CI01000300_02313596_02320912 NA other downstream 763021 2312515 ~ 2321088 (+)
G409984 NA other downstream 1721297 3271685 ~ 3272398 (+)
CI01000300_03901275_03902800 NA other downstream 2350800 3901148 ~ 3902892 (+)

Expression


Co-expression Network