G409028


Basic Information

Item Value
gene id G409028
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 1963272 ~ 1964097 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU469964
TGTGGCTACATTTTTAATAATTATTTTTTGATTATACAAACATCAATATATACAAACATTTAAAGACTGAAAGGAAAAGAGTAAACAACAAGGCTTCCTAGCACAGGAGATCATCGTGGATTTTCTTGAGGACTTTTGTCAGATAGTTCTTGGCTGGTTTGATTGATGATAGGATGTCTTCAATTTGACTCAACCTTGTTTTCCCCATGTGTTTTTTGAAGTCCTGTATGTGAAGTGGTCCAAAGGGATAGTCTGGAGTGACTATCAGATTTAACTCAAACTTTTCAAATGCTTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU469964 True 296 lncRNA 0.34 2 1963272 1964097

Neighbor

gene id symbol gene type direction distance location
CI01000300_01801423_01807504 CNGA3 coding upstream 155147 1801423 ~ 1808125 (+)
CI01000300_01772239_01783579 ATP1B1B, ATP1B1 coding upstream 179471 1771784 ~ 1783801 (+)
CI01000300_01753916_01754815 NA coding upstream 208292 1753916 ~ 1754980 (+)
CI01000300_01571005_01611574 DACHB coding upstream 351698 1569612 ~ 1611574 (+)
CI01000300_01527830_01531871 NA coding upstream 431253 1527830 ~ 1532019 (+)
CI01000300_01976057_01980856 NA coding downstream 11960 1976057 ~ 1981187 (+)
CI01000300_02313596_02320912 NA coding downstream 348418 2312515 ~ 2321088 (+)
CI01000300_02340225_02344792 NA coding downstream 374691 2338788 ~ 2344976 (+)
CI01000300_02356651_02369301 EIF3B coding downstream 392299 2356396 ~ 2370981 (+)
CI01000300_02372157_02389226 NA coding downstream 407670 2371767 ~ 2389411 (+)
G409018 NA non-coding upstream 3682 1930231 ~ 1959590 (+)
G409006 NA non-coding upstream 84399 1878286 ~ 1878873 (+)
G408976 NA non-coding upstream 176548 1786494 ~ 1786724 (+)
G408929 NA non-coding upstream 218499 1735498 ~ 1744773 (+)
G408934 NA non-coding upstream 232845 1725424 ~ 1730427 (+)
G409117 NA non-coding downstream 340972 2305069 ~ 2306889 (+)
G409141 NA non-coding downstream 373466 2337563 ~ 2337787 (+)
G409155 NA non-coding downstream 442414 2406511 ~ 2406856 (+)
G409174 NA non-coding downstream 496993 2461090 ~ 2461979 (+)
G408910 NA other upstream 328303 1633030 ~ 1634969 (+)
G408498 NA other upstream 942538 1017067 ~ 1020734 (+)
G408510 NA other upstream 986173 976600 ~ 977099 (+)
G409984 NA other downstream 1307588 3271685 ~ 3272398 (+)
CI01000300_03901275_03902800 NA other downstream 1937091 3901148 ~ 3902892 (+)
G410382 NA other downstream 2159601 4123698 ~ 4124416 (+)
G410388 NA other downstream 2231549 4195646 ~ 4196555 (+)

Expression


Co-expression Network