G409251


Basic Information

Item Value
gene id G409251
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 2601741 ~ 2601964 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU470223
GCTTAATTTTAGCTATGAATTATTACATGAAAATTTTTCCCCAAAATGGTAAATGTGTCTGCTGCTTCGGGGTAAGTTGTGCCAGTGTTTGAAAGAATAGTCATAGTTCCTGCTTTTAGATACAAATCTTAAAGGGTTAGTTCACCTAAAAATGAAAATTCTGTCATTATTTACTCACCCTCATGTCGTTTCACACCCATAAGACCTTCGTTCATCTTCGGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU470223 True 224 lncRNA 0.36 1 2601741 2601964

Neighbor

gene id symbol gene type direction distance location
CI01000300_02573883_02577623 NA coding upstream 24118 2572591 ~ 2577623 (+)
CI01000300_02553990_02570561 SLC24A2 coding upstream 30808 2553473 ~ 2570933 (+)
CI01000300_02529181_02537776 TSPAN5.S, TSPAN5.L, TSPAN5A, TSPAN5B, TSPAN5, TSN5 coding upstream 63965 2529181 ~ 2537776 (+)
CI01000300_02481007_02486342 SNX8B coding upstream 114674 2478874 ~ 2487067 (+)
CI01000300_02477372_02477542 NA coding upstream 124192 2477311 ~ 2477549 (+)
CI01000300_02636916_02637474 NA coding downstream 34909 2636873 ~ 2637668 (+)
CI01000300_02658543_02666317 STRA6L coding downstream 56579 2658543 ~ 2666738 (+)
CI01000300_02668633_02682257 TDRD7A coding downstream 66669 2668633 ~ 2682738 (+)
CI01000300_02686699_02695556 TMOD1 coding downstream 84735 2686699 ~ 2696028 (+)
CI01000300_02723637_02737142 GNE coding downstream 121673 2723637 ~ 2737891 (+)
G409246 NA non-coding upstream 15828 2585699 ~ 2585913 (+)
G409172 NA non-coding upstream 96240 2493449 ~ 2505501 (+)
G409205 NA non-coding upstream 136630 2464479 ~ 2465111 (+)
G409174 NA non-coding upstream 139762 2461090 ~ 2461979 (+)
G409155 NA non-coding upstream 194885 2406511 ~ 2406856 (+)
G409163 NA non-coding downstream 19074 2621038 ~ 2630438 (+)
G409188 NA non-coding downstream 37558 2639522 ~ 2639910 (+)
G409273 NA non-coding downstream 108709 2710673 ~ 2710889 (+)
G409284 NA non-coding downstream 174183 2776147 ~ 2776359 (+)
CI01000300_02313596_02320912 NA other upstream 287847 2312515 ~ 2321088 (+)
CI01000300_01753916_01754815 NA other upstream 842705 1753916 ~ 1754980 (+)
G408910 NA other upstream 966772 1633030 ~ 1634969 (+)
G408498 NA other upstream 1581007 1017067 ~ 1020734 (+)
G408510 NA other upstream 1624642 976600 ~ 977099 (+)
G409984 NA other downstream 669721 3271685 ~ 3272398 (+)
CI01000300_03901275_03902800 NA other downstream 1299224 3901148 ~ 3902892 (+)
G410382 NA other downstream 1521734 4123698 ~ 4124416 (+)
G410388 NA other downstream 1593682 4195646 ~ 4196555 (+)
CI01000300_05891147_05892754 HELT other downstream 3289103 5891021 ~ 5892824 (+)

Expression


Co-expression Network