G409292


Basic Information

Item Value
gene id G409292
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 2792314 ~ 2792522 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU470266
TAGGATGGATGCTTACTTAGAAGGCATCTGGCTTTGTAGGCACTATACAGTGAGGCTGCTTAGCAGAATGATCTAATGTATGGTAAAAATGTAAACCTCTCAATGACAGTATTCAGGCCATATGTGTCAAATATCAGTTACTTAATATTAACATCTTGCTTTGCTCACAGTTGGTTGAAAACATTCTGAAGTAACATGCAGGTTCAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU470266 True 209 lncRNA 0.37 1 2792314 2792522

Neighbor

gene id symbol gene type direction distance location
CI01000300_02772428_02774786 NA coding upstream 17340 2772307 ~ 2774974 (+)
CI01000300_02744370_02753382 CLTA coding upstream 38361 2744370 ~ 2753953 (+)
CI01000300_02738497_02743503 NANS, SIAS, NANSA coding upstream 48771 2738497 ~ 2743543 (+)
CI01000300_02723637_02737142 GNE coding upstream 54423 2723637 ~ 2737891 (+)
CI01000300_02686699_02695556 TMOD1 coding upstream 96286 2686699 ~ 2696028 (+)
CI01000300_02990347_03008777 PCDH10, PCDH10A coding downstream 197176 2989698 ~ 3008864 (+)
CI01000300_03694786_03699730 NOCTB coding downstream 902264 3694786 ~ 3699973 (+)
CI01000300_03744731_03749017 NA coding downstream 951888 3744410 ~ 3749023 (+)
CI01000300_03752633_03755353 NA coding downstream 960111 3752633 ~ 3756860 (+)
CI01000300_03769789_03773233 NA coding downstream 975677 3768199 ~ 3773262 (+)
G409284 NA non-coding upstream 15955 2776147 ~ 2776359 (+)
G409273 NA non-coding upstream 81425 2710673 ~ 2710889 (+)
G409188 NA non-coding upstream 152404 2639522 ~ 2639910 (+)
CI01000300_02636916_02637474 NA non-coding upstream 154646 2636873 ~ 2637668 (+)
G409163 NA non-coding upstream 161876 2621038 ~ 2630438 (+)
G409294 NA non-coding downstream 8767 2801289 ~ 2801570 (+)
G409295 NA non-coding downstream 28003 2820525 ~ 2820766 (+)
G409301 NA non-coding downstream 45666 2838188 ~ 2838672 (+)
G409302 NA non-coding downstream 55071 2847593 ~ 2847932 (+)
G409306 NA non-coding downstream 70524 2863046 ~ 2863624 (+)
CI01000300_02313596_02320912 NA other upstream 478420 2312515 ~ 2321088 (+)
CI01000300_01753916_01754815 NA other upstream 1033278 1753916 ~ 1754980 (+)
G408910 NA other upstream 1157345 1633030 ~ 1634969 (+)
G408498 NA other upstream 1771580 1017067 ~ 1020734 (+)
G408510 NA other upstream 1815215 976600 ~ 977099 (+)
G409984 NA other downstream 479163 3271685 ~ 3272398 (+)
CI01000300_03901275_03902800 NA other downstream 1108666 3901148 ~ 3902892 (+)
G410382 NA other downstream 1331176 4123698 ~ 4124416 (+)
G410388 NA other downstream 1403124 4195646 ~ 4196555 (+)
CI01000300_05891147_05892754 HELT other downstream 3098545 5891021 ~ 5892824 (+)

Expression


Co-expression Network