G409334


Basic Information

Item Value
gene id G409334
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 2975426 ~ 2975682 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU470308
CCCCATATCATCCAAGATGTCCATCCCCTTCTCTCTTCAGTCGAAAAGAAATTAAGGTTTTTGATGAAAACATTCCAGGATTTTTCTCCATATAGTGGACTTCAATAGTCTCCAAACGGTTGAAGGTCAAAATTACAGTTTCAGTGCAGCTTCAAAGGGCTTTAAATGATACCAGACGAGGAATAAGGGTCTTATCTAGAGAAACCATCGCTCATTTTCTAAAAAAAAATTAAAAATTATATACGTTTTAACCATAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU470308 True 257 lncRNA 0.35 1 2975426 2975682

Neighbor

gene id symbol gene type direction distance location
CI01000300_02772428_02774786 NA coding upstream 200452 2772307 ~ 2774974 (+)
CI01000300_02744370_02753382 CLTA coding upstream 221473 2744370 ~ 2753953 (+)
CI01000300_02738497_02743503 NANS, SIAS, NANSA coding upstream 231883 2738497 ~ 2743543 (+)
CI01000300_02723637_02737142 GNE coding upstream 237535 2723637 ~ 2737891 (+)
CI01000300_02686699_02695556 TMOD1 coding upstream 279398 2686699 ~ 2696028 (+)
CI01000300_02990347_03008777 PCDH10, PCDH10A coding downstream 14016 2989698 ~ 3008864 (+)
CI01000300_03694786_03699730 NOCTB coding downstream 719104 3694786 ~ 3699973 (+)
CI01000300_03744731_03749017 NA coding downstream 768728 3744410 ~ 3749023 (+)
CI01000300_03752633_03755353 NA coding downstream 776951 3752633 ~ 3756860 (+)
CI01000300_03769789_03773233 NA coding downstream 792517 3768199 ~ 3773262 (+)
G409329 NA non-coding upstream 8064 2967147 ~ 2967362 (+)
G409319 NA non-coding upstream 61308 2913894 ~ 2914118 (+)
G409310 NA non-coding upstream 101382 2873839 ~ 2874044 (+)
G409309 NA non-coding upstream 103202 2871893 ~ 2872224 (+)
G409308 NA non-coding upstream 104974 2870181 ~ 2870452 (+)
G409336 NA non-coding downstream 41225 3016907 ~ 3018272 (+)
G409357 NA non-coding downstream 100621 3076303 ~ 3076514 (+)
G409970 NA non-coding downstream 208828 3184510 ~ 3184728 (+)
G409975 NA non-coding downstream 242163 3217845 ~ 3288158 (+)
G410148 NA non-coding downstream 424898 3400580 ~ 3400787 (+)
CI01000300_02313596_02320912 NA other upstream 661532 2312515 ~ 2321088 (+)
CI01000300_01753916_01754815 NA other upstream 1216390 1753916 ~ 1754980 (+)
G408910 NA other upstream 1340457 1633030 ~ 1634969 (+)
G408498 NA other upstream 1954692 1017067 ~ 1020734 (+)
G408510 NA other upstream 1998327 976600 ~ 977099 (+)
G409984 NA other downstream 296003 3271685 ~ 3272398 (+)
CI01000300_03901275_03902800 NA other downstream 925506 3901148 ~ 3902892 (+)
G410382 NA other downstream 1148016 4123698 ~ 4124416 (+)
G410388 NA other downstream 1219964 4195646 ~ 4196555 (+)
CI01000300_05891147_05892754 HELT other downstream 2915385 5891021 ~ 5892824 (+)

Expression


Co-expression Network