G410335


Basic Information

Item Value
gene id G410335
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 3876685 ~ 3877036 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU471414
AGTCCATGATTTTGTACATGTATTTGACTGCATCTATAATATTTATGTCCCTGTAAATCATTTCTTTTAAGTGGACTTAAATAAATTGTTAAAATGTATGTGTACACAACTGCTGATGGGGTCTCTTTTCATTTTTTGTATGCTTCAAAGACCCTTATGATGATGGTTTGTGTCAATATGCATTGTGATTATGATCCATGTTGGCTTTTTCTTTTTTTTCTTTTTTTGCATGTTTTGTGTAAGTGTATGCTGTTACAATATATTCTACTACTTTGTAACATTGCAGGTCAGTTTCATCTAGTCTTGTAAAATATAGACTATCGTCTGTTGGGCAAAGAAAAAAAAAATTAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU471414 True 352 lncRNA 0.30 1 3876685 3877036

Neighbor

gene id symbol gene type direction distance location
CI01000300_03773519_03831065 NA coding upstream 45263 3773362 ~ 3831422 (+)
CI01000300_03769789_03773233 NA coding upstream 103423 3768199 ~ 3773262 (+)
CI01000300_03752633_03755353 NA coding upstream 119825 3752633 ~ 3756860 (+)
CI01000300_03744731_03749017 NA coding upstream 127662 3744410 ~ 3749023 (+)
CI01000300_03694786_03699730 NOCTB coding upstream 176712 3694786 ~ 3699973 (+)
CI01000300_03901275_03902800 NA coding downstream 24112 3901148 ~ 3902892 (+)
CI01000300_03924558_03934407 PPP2R2CA, PPP2R2C coding downstream 47522 3924558 ~ 3935360 (+)
CI01000300_03954605_03969070 CRMP1 coding downstream 77569 3954605 ~ 3970439 (+)
CI01000300_03972562_03976190 NA coding downstream 95526 3972562 ~ 3976225 (+)
CI01000300_03981015_03991839 NA coding downstream 103979 3981015 ~ 3992010 (+)
G410334 NA non-coding upstream 583 3875892 ~ 3876102 (+)
G410263 NA non-coding upstream 157943 3707467 ~ 3718742 (+)
G410253 NA non-coding upstream 292571 3583880 ~ 3584114 (+)
G410242 NA non-coding upstream 322699 3553750 ~ 3553986 (+)
G410240 NA non-coding upstream 323650 3552829 ~ 3553035 (+)
G410345 NA non-coding downstream 34338 3911374 ~ 3913993 (+)
G410320 NA non-coding downstream 39725 3916761 ~ 3938947 (+)
G410323 NA non-coding downstream 62001 3939037 ~ 3939682 (+)
G410353 NA non-coding downstream 75794 3952830 ~ 3953045 (+)
G410354 NA non-coding downstream 76140 3953176 ~ 3953414 (+)
G409984 NA other upstream 604287 3271685 ~ 3272398 (+)
CI01000300_02313596_02320912 NA other upstream 1562791 2312515 ~ 2321088 (+)
CI01000300_01753916_01754815 NA other upstream 2117649 1753916 ~ 1754980 (+)
G408910 NA other upstream 2241716 1633030 ~ 1634969 (+)
G408498 NA other upstream 2855951 1017067 ~ 1020734 (+)
G410382 NA other downstream 246662 4123698 ~ 4124416 (+)
G410388 NA other downstream 318610 4195646 ~ 4196555 (+)
CI01000300_05891147_05892754 HELT other downstream 2014031 5891021 ~ 5892824 (+)
G411777 NA other downstream 2592209 6469245 ~ 6469705 (+)

Expression


Co-expression Network