G414420


Basic Information

Item Value
gene id G414420
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 10408193 ~ 10408544 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU475960
ACAGTGCCAAAGCTACCAGTACCTGGTTTAAGGACCATGGTACCCCTGTTTTTAATTGGCCAGCAAACTCGCCTGACCTTAACCCCATAGAAAATCTATGGGGTATTGTGAAGAGGAAGATGTGATATGCCAGACCCAACAATGCAGAAGAGCTGAAGGCGACTATCAGAGCAACCTGGGCTCTTATAACACCTGAGCAGTGCCACAGACTGATCGACTCCATGCCACGCTGCATTGCTGCAGTAATTCGGGCAAAAGGAGCCCCAACTAAGTATTGAGTGCTGTACATGCTCATACTTTTCATGTTCATACTTTTCAGTTGGCCAAGATTTCTAAAAATCCTTTCTTTGTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU475960 True 352 lncRNA 0.45 1 10408193 10408544

Neighbor

gene id symbol gene type direction distance location
CI01000300_10401994_10404248 NPY2R coding upstream 3518 10401565 ~ 10404675 (+)
CI01000300_10387736_10392987 LRAT, LRATA coding upstream 15151 10387176 ~ 10393042 (+)
CI01000300_10357507_10366851 PLRG1 coding upstream 41185 10357507 ~ 10367008 (+)
CI01000300_10167118_10172235 NA coding upstream 235958 10167118 ~ 10172235 (+)
CI01000300_10094312_10098589 NA coding upstream 309524 10093932 ~ 10098669 (+)
CI01000300_10445111_10492819 GUCY1A3, GUCY1B3 coding downstream 36567 10445111 ~ 10493542 (+)
CI01000300_10496235_10498777 FABP2 coding downstream 87630 10496174 ~ 10498944 (+)
CI01000300_10604458_10604787 NA coding downstream 195914 10604458 ~ 10605033 (+)
CI01000300_10661680_10669987 MXD4.L, MXD4 coding downstream 253136 10661680 ~ 10674265 (+)
CI01000300_10675299_10675754 NDUFB6 coding downstream 266045 10674589 ~ 10676912 (+)
G414266 NA non-coding upstream 501 10407292 ~ 10407692 (+)
G414419 NA non-coding upstream 1577 10406296 ~ 10406616 (+)
G414411 NA non-coding upstream 24304 10383616 ~ 10383889 (+)
G414409 NA non-coding upstream 26201 10381761 ~ 10381992 (+)
G414405 NA non-coding upstream 33019 10374948 ~ 10375174 (+)
G414274 NA non-coding downstream 239 10408783 ~ 10409068 (+)
G414270 NA non-coding downstream 2381 10410925 ~ 10411671 (+)
G414425 NA non-coding downstream 7495 10416039 ~ 10416408 (+)
G414423 NA non-coding downstream 10015 10418559 ~ 10419139 (+)
G414424 NA non-coding downstream 11009 10419553 ~ 10419780 (+)
G414249 NA other upstream 34295 10369911 ~ 10373898 (+)
G413459 NA other upstream 1459590 8857687 ~ 8948603 (+)
G411777 NA other upstream 3938488 6469245 ~ 6469705 (+)
CI01000300_05891147_05892754 HELT other upstream 4515768 5891021 ~ 5892824 (+)
G410388 NA other upstream 6211638 4195646 ~ 4196555 (+)
CI01000300_11704476_11708232 NA other downstream 1294940 11704476 ~ 11708351 (+)

Expression


Co-expression Network