CI01000304_05173869_05175309 (NRARP, NRARP.L, NRARPA, NRARPB)


Basic Information

Item Value
gene id CI01000304_05173869_05175309
gene name NRARP, NRARP.L, NRARPA, NRARPB
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 5173426 ~ 5176791 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000304_05173869_05175309.mRNA
GGATATATACCTTAGTCAGTGACTGCATTTACACACCAAGTGTGTCGTTTACTTGTCCTTTTTGGGATATACGCTTGTCTTATTTCTAGTCTCACATGCCTAAACTGGTTTTAGTCCAGTAAAGCCGCTAATATATCCAAGTTATCCAAGTACTAGAGACGGTAAAGGCGAAAAGAGGCGGTTTAAAGCATCATGAGCCAGGCGGATATATCGACGTGCTCGGCGCCCCAGAGAGTCTTCCAGGAGGCGGTGAAGAAAGGCAACACGAAGGAGCTCCATTCACTACTGCAGAACATGACCAACTGCGAGTTTAACGTCAACTCCTTCGGCCCCGAGGGACAGACGGCGCTGCACCAGTCGGTCATCGACGGGAATTTGGAGCTCGTGAAACTGCTGGTGAAATTCGGAGCCGATATTCGGCTGGCGAACCGAGAGGGATGGAGCGCGTTGCACATCGCCGCTTTTGGGGGACACCAAGACATCGTGTTATACCTCATCACCAAGGCCAAGTACTCCTCCGGCGCGCGCTACCTCGACTTGAAAGTATTCGACAATATCATATGCTCTCTTTCTCAAGCCTTCTCCTTAACTCTTCTCAGTTACCCACTAGTGCTCAACAGAATCAGTAGGCCCTGTTTGGGTAATTTTACTTGATGTTTTCTTATTGTCATTCTCGTTTTTTATAATCTTCACTCGGGACAATTTATCTCCGCGAACCAAAATTAAGATCCATTGGTTATTCAAAACATTTTTTCGTTCGTCAAGCATGGTTGAGACATTGTATATGTAGGTTAAGCTTACTGCTTAATTTTGCATTGTCATTTTTTGTTTGCATTTTAGTTACAAAAAGTGAAATGCGTTGCATGACTA

Function

symbol description
nrarpa Involved in branching involved in blood vessel morphogenesis and regulation of cell-cell adhesion. Acts upstream of or within blood vessel endothelial cell proliferation involved in sprouting angiogenesis; neural crest cell migration; and pigment cell differentiation. Is expressed in several structures, including germ ring; pronephros; segmental plate; somite border; and trunk vasculature. Orthologous to human NRARP (NOTCH regulated ankyrin repeat protein).
nrarpb Involved in branching involved in blood vessel morphogenesis and regulation of cell-cell adhesion. Acts upstream of or within blood vessel endothelial cell proliferation involved in sprouting angiogenesis. Is expressed in central nervous system; neural plate; neural rod; neural tube; and segmental plate. Orthologous to human NRARP (NOTCH regulated ankyrin repeat protein).
nrarp Involved in Notch signaling pathway. Acts upstream of or within negative regulation of Notch signaling pathway and positive regulation of canonical Wnt signaling pathway.

GO:

id name namespace
GO:0032525 somite rostral/caudal axis specification biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000304_05173869_05175309.mRNA False 870 mRNA 0.45 2 5173677 5175525

Neighbor

gene id symbol gene type direction distance location
CI01000304_05149465_05165999 NA coding upstream 7505 5148697 ~ 5166172 (+)
CI01000304_05122605_05137890 EXD3 coding upstream 35508 5122605 ~ 5138169 (+)
CI01000304_05085761_05095609 AK3 coding upstream 77426 5085596 ~ 5096251 (+)
CI01000304_04989817_04997932 NA coding upstream 175745 4988362 ~ 4997932 (+)
CI01000304_04902333_04911640 LIN54 coding upstream 261899 4900215 ~ 4911778 (+)
CI01000304_05277392_05292162 DBH coding downstream 101576 5277101 ~ 5292162 (+)
CI01000304_05394708_05400373 NA coding downstream 218327 5393852 ~ 5400616 (+)
CI01000304_05489571_05504308 NA coding downstream 314000 5489525 ~ 5508080 (+)
CI01000304_05541965_05547732 NA coding downstream 366013 5541538 ~ 5547877 (+)
CI01000304_05584729_05612753 STRBP coding downstream 409204 5584729 ~ 5612798 (+)
G420600 NA non-coding upstream 95402 5067544 ~ 5078275 (+)
G420530 NA non-coding upstream 135015 5037371 ~ 5038662 (+)
G420747 NA non-coding upstream 136621 5036696 ~ 5037056 (+)
G420746 NA non-coding upstream 137057 5036395 ~ 5036620 (+)
G420544 NA non-coding upstream 230158 4940767 ~ 4943519 (+)
G420517 NA non-coding downstream 15079 5190604 ~ 5197784 (+)
G420538 NA non-coding downstream 26747 5202272 ~ 5206967 (+)
G420785 NA non-coding downstream 31785 5207310 ~ 5207655 (+)
G420786 NA non-coding downstream 32178 5207703 ~ 5207923 (+)
G420787 NA non-coding downstream 33249 5208774 ~ 5209519 (+)
G420445 NA other upstream 869845 4303336 ~ 4303832 (+)
G418981 NA other upstream 3079999 2092494 ~ 2093678 (+)
G418116 NA other upstream 4298428 872670 ~ 875249 (+)
G418059 NA other upstream 4609226 558092 ~ 564451 (+)
G417987 NA other upstream 4945824 226703 ~ 227853 (+)
G421162 NA other downstream 1065708 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 2177124 7352621 ~ 7354396 (+)
G421435 NA other downstream 2308616 7484141 ~ 7484688 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A other downstream 2803103 7979078 ~ 7980735 (+)
CI01000304_08232073_08235598 NA other downstream 3056469 8231293 ~ 8235655 (+)

Expression


Co-expression Network