G417904


Basic Information

Item Value
gene id G417904
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 26033 ~ 26244 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU480040
TCAGCTCAGGGTCTGTGGAGGACTCATCAGCTCTCGTGGCACATAAATTGCCTGGAGATGATGGCGGTCTTCAATGCGTTGAAGTTCTTCCTTCCAGACCTGAGGGGCCATCATGTGCTTGTCAGGACAGACAACACATCAGTGGTCTCTTATATAAATCGACAGGGGGGTCTGCGGTCGCGTCCACTATGCAAACTGGCGCACCAGATCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU480040 True 212 lncRNA 0.53 1 26033 26244

Neighbor

gene id symbol gene type direction distance location
CI01000304_00047400_00073206 NA coding downstream 20078 46322 ~ 73338 (+)
CI01000304_00292894_00306187 PHAX coding downstream 266650 292894 ~ 306479 (+)
CI01000304_00308220_00310793 NA coding downstream 281429 307673 ~ 311267 (+)
CI01000304_00315935_00342330 LMNB1 coding downstream 288498 314742 ~ 342531 (+)
CI01000304_00370333_00419672 MEGF10 coding downstream 344089 370333 ~ 420755 (+)
G417907 NA non-coding downstream 19293 45537 ~ 45789 (+)
G417900 NA non-coding downstream 60716 86960 ~ 89259 (+)
G417937 NA non-coding downstream 108602 134846 ~ 135133 (+)
G417939 NA non-coding downstream 110890 137134 ~ 137631 (+)
G417941 NA non-coding downstream 112969 139213 ~ 139451 (+)
G417987 NA other downstream 200459 226703 ~ 227853 (+)
G418059 NA other downstream 531848 558092 ~ 564451 (+)
G418116 NA other downstream 846426 872670 ~ 875249 (+)
G418981 NA other downstream 2066250 2092494 ~ 2093678 (+)
G420445 NA other downstream 4277092 4303336 ~ 4303832 (+)

Expression


Co-expression Network