G418295


Basic Information

Item Value
gene id G418295
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 26033 ~ 26244 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU480472
AGGATCTGGTGCGCCAGTTTGCATAGTGGACGCGACCGCAGACCCCCCTGTCGATTTATATAAGAGACCACTGATGTGTTGTCTGTCCTGACAAGCACATGATGGCCCCTCAGGTCTGGAAGGAAGAACTTCAACGCATTGAAGACCGCCATCATCTCCAGGCAATTTATGTGCCACGAGAGCTGATGAGTCCTCCACAGACCCTGAGCTGA

Function

NR:

description
small glutamine-rich tetratricopeptide repeat-containing protein alpha-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU480472 True 212 lncRNA 0.53 1 26033 26244

Neighbor

gene id symbol gene type direction distance location
CI01000304_00088915_00116828 NA coding upstream 61920 88164 ~ 116828 (-)
CI01000304_00140443_00163606 NA coding upstream 113446 139690 ~ 163683 (-)
CI01000304_00167148_00268194 ALDH7A1 coding upstream 140904 167148 ~ 268194 (-)
CI01000304_00348539_00351333 NA coding upstream 322251 347671 ~ 351333 (-)
CI01000304_00670372_00671143 NA coding upstream 643032 669276 ~ 671143 (-)
G418300 NA non-coding upstream 19259 45503 ~ 45725 (-)
G418314 NA non-coding upstream 105522 131766 ~ 131982 (-)
G418291 NA non-coding upstream 151881 178125 ~ 251292 (-)
G418276 NA non-coding upstream 259071 285315 ~ 342503 (-)
G418271 NA non-coding upstream 266662 292906 ~ 306910 (-)
G419353 NA other upstream 2203140 2229384 ~ 2236106 (-)
G419354 NA other upstream 2236258 2262502 ~ 2266241 (-)
CI01000304_04263955_04264962 NA other upstream 4237501 4263846 ~ 4265201 (-)
CI01000304_04661808_04672936 PPWD1 other upstream 4635572 4661766 ~ 4672947 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 6451207 6480743 ~ 6483986 (-)

Expression


Co-expression Network