G417907



Basic Information


Item Value
gene id G417907
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 45537 ~ 45789 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU480043
TAACTACATTACCTCAGATGGATGAATGGTTGGATTCCACAACTGGTAAAATAAAACATATATAAGAAAATACAACATTTACTGTAGGAGCCATACAATTTACTGGTGACTTAATTTAAAAAAACTGTTCTATTGCGCTTCTGATTTGGCAGTGAAATTCGCCGATTTTGGGTGCGTAAGATGTGAAGGATTCTATGGTCCAGTTAGTATTTTCACCCCATAATGGCCGCCGCGCTACCGGCGCGCCATCCAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU480043 True 253 lncRNA 0.40 1 45537 45789

Neighbor


gene id symbol gene type direction distance location
CI01000304_00047400_00073206 NA coding downstream 533 46322 ~ 73338 (+)
CI01000304_00292894_00306187 PHAX coding downstream 247105 292894 ~ 306479 (+)
CI01000304_00308220_00310793 NA coding downstream 261884 307673 ~ 311267 (+)
CI01000304_00315935_00342330 LMNB1 coding downstream 268953 314742 ~ 342531 (+)
CI01000304_00370333_00419672 MEGF10 coding downstream 324544 370333 ~ 420755 (+)
G417904 NA non-coding upstream 19293 26033 ~ 26244 (+)
G417900 NA non-coding downstream 41171 86960 ~ 89259 (+)
G417937 NA non-coding downstream 89057 134846 ~ 135133 (+)
G417939 NA non-coding downstream 91345 137134 ~ 137631 (+)
G417941 NA non-coding downstream 93424 139213 ~ 139451 (+)
G417942 NA non-coding downstream 93743 139532 ~ 139853 (+)
G417987 NA other downstream 180914 226703 ~ 227853 (+)
G418059 NA other downstream 512303 558092 ~ 564451 (+)
G418116 NA other downstream 826881 872670 ~ 875249 (+)
G418981 NA other downstream 2046705 2092494 ~ 2093678 (+)
G420445 NA other downstream 4257547 4303336 ~ 4303832 (+)

Expression



Co-expression Network