G417941



Basic Information


Item Value
gene id G417941
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 139213 ~ 139451 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU480081
ATTTATGTTTAAAATACTAGAAAAAGTTGTGTCGTCCCAATTGTGCTCCTTCTTGCAAAAAAAAAAGAAAAAGAAATTCAGGATTCAGGATTTAGGCCTCATCATAGCACAGAAACTGCACTCATTAAAATTACAAATGACTTACTTTTAGCTTCTGACCAAGGCTGTATCTCAGTATTTGTTTTACTTGATCTCAGTGCTGCGTTTGACACTATAGATCATAAAATACTCCTAGACCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU480081 True 239 lncRNA 0.34 1 139213 139451
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000304_00047400_00073206 NA coding upstream 65875 46322 ~ 73338 (+)
CI01000304_00292894_00306187 PHAX coding downstream 153443 292894 ~ 306479 (+)
CI01000304_00308220_00310793 NA coding downstream 168222 307673 ~ 311267 (+)
CI01000304_00315935_00342330 LMNB1 coding downstream 175291 314742 ~ 342531 (+)
CI01000304_00370333_00419672 MEGF10 coding downstream 230882 370333 ~ 420755 (+)
CI01000304_00424703_00434890 PRRC1 coding downstream 285252 424703 ~ 435066 (+)
G417939 NA non-coding upstream 1582 137134 ~ 137631 (+)
G417937 NA non-coding upstream 4080 134846 ~ 135133 (+)
G417900 NA non-coding upstream 49954 86960 ~ 89259 (+)
G417907 NA non-coding upstream 93424 45537 ~ 45789 (+)
G417904 NA non-coding upstream 112969 26033 ~ 26244 (+)
G417942 NA non-coding downstream 81 139532 ~ 139853 (+)
G417943 NA non-coding downstream 692 140143 ~ 140471 (+)
G417944 NA non-coding downstream 1367 140818 ~ 141241 (+)
G417945 NA non-coding downstream 2103 141554 ~ 141798 (+)
G417946 NA non-coding downstream 2639 142090 ~ 142486 (+)
G417987 NA other downstream 87252 226703 ~ 227853 (+)
G418059 NA other downstream 418641 558092 ~ 564451 (+)
G418116 NA other downstream 733219 872670 ~ 875249 (+)
G418981 NA other downstream 1953043 2092494 ~ 2093678 (+)
G420445 NA other downstream 4163885 4303336 ~ 4303832 (+)

Expression


G417941 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

G417941 Expression in each Bioproject

Bar chart with 16 bars.
G417941 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G373365 NA non-coding NC_048569.1 CM023223.2 17298991 ~ 17299291 (-)
striped catfish (Pangasianodon hypophthalmus) G358282 NA non-coding NC_047619.1 CM018565.1 60658 ~ 60895 (+)