G418056


Basic Information

Item Value
gene id G418056
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 478679 ~ 478899 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU480221
GTGATTGTCACACAACTCCAACAGAAATTCAATGACGTAAAGGTTGTAATGTGATTTATCAAGGCACACGTGATCCATTGACCATTCTGCTTTCTCCATGGTACAGGTTGGTATCTCCCCATAATAAGAAAATCTCTGGCTGCACTCACATGATATGTCAGTGTAACAGAGGCCTGCTGCTAAGGGTTGTGCAGTAAACCTCACTCCCCAGACTTCAAGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU480221 True 221 lncRNA 0.44 1 478679 478899

Neighbor

gene id symbol gene type direction distance location
CI01000304_00453663_00453991 CTXN3 coding upstream 23439 453663 ~ 455240 (+)
CI01000304_00424703_00434890 PRRC1 coding upstream 43613 424703 ~ 435066 (+)
CI01000304_00370333_00419672 MEGF10 coding upstream 57924 370333 ~ 420755 (+)
CI01000304_00315935_00342330 LMNB1 coding upstream 136156 314742 ~ 342531 (+)
CI01000304_00308220_00310793 NA coding upstream 167412 307673 ~ 311267 (+)
CI01000304_00480135_00531529 NA coding downstream 882 479781 ~ 532037 (+)
CI01000304_00695426_00725459 SLC27A6 coding downstream 215562 694461 ~ 725459 (+)
CI01000304_00728178_00731945 ISOC1, ISOC1.L coding downstream 249057 727956 ~ 732274 (+)
CI01000304_00757894_00760456 NA coding downstream 278995 757894 ~ 760660 (+)
CI01000304_00772995_00827316 CHSY3 coding downstream 292134 771033 ~ 827608 (+)
G418050 NA non-coding upstream 8107 470215 ~ 470572 (+)
G418047 NA non-coding upstream 37807 440584 ~ 440872 (+)
G418023 NA non-coding upstream 197653 279893 ~ 281026 (+)
G418024 NA non-coding upstream 200697 277261 ~ 277982 (+)
G418004 NA non-coding downstream 42785 521684 ~ 526522 (+)
G418003 NA non-coding downstream 71374 550273 ~ 551981 (+)
G418058 NA non-coding downstream 78692 557591 ~ 557792 (+)
G418077 NA non-coding downstream 118387 597286 ~ 597663 (+)
G418079 NA non-coding downstream 121641 600540 ~ 600753 (+)
G417987 NA other upstream 250826 226703 ~ 227853 (+)
G418059 NA other downstream 79193 558092 ~ 564451 (+)
G418116 NA other downstream 393771 872670 ~ 875249 (+)
G418981 NA other downstream 1613595 2092494 ~ 2093678 (+)
G420445 NA other downstream 3824437 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 4694324 5173426 ~ 5176791 (+)

Expression


Co-expression Network