G418156


Basic Information

Item Value
gene id G418156
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 693350 ~ 693603 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU480324
CACCAATCAAAACAAGTCTGGAATAATTATGATTTTTAAGCCCGGTTTCACAGACAGGGCTTAGACTAACTGACTAAGCCAGGATTAGGCCTTAGTTCAGTTAAGACATTTAAGTAGCTTTTATAAATGTACCCTAAAAAGAAACATTACTGGTGTGCATCTTGAGACAAAACAATGGCACTGACATATTTTAAGATATGTCAGTGCAAGTTGCTTATGGAGTAATGATGCTGAAAAATAAGCTTTGATCACAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU480324 True 254 lncRNA 0.36 1 693350 693603

Neighbor

gene id symbol gene type direction distance location
CI01000304_00480135_00531529 NA coding upstream 161313 479781 ~ 532037 (+)
CI01000304_00453663_00453991 CTXN3 coding upstream 238110 453663 ~ 455240 (+)
CI01000304_00424703_00434890 PRRC1 coding upstream 258284 424703 ~ 435066 (+)
CI01000304_00370333_00419672 MEGF10 coding upstream 272595 370333 ~ 420755 (+)
CI01000304_00315935_00342330 LMNB1 coding upstream 350827 314742 ~ 342531 (+)
CI01000304_00695426_00725459 SLC27A6 coding downstream 858 694461 ~ 725459 (+)
CI01000304_00728178_00731945 ISOC1, ISOC1.L coding downstream 34353 727956 ~ 732274 (+)
CI01000304_00757894_00760456 NA coding downstream 64291 757894 ~ 760660 (+)
CI01000304_00772995_00827316 CHSY3 coding downstream 77430 771033 ~ 827608 (+)
CI01000304_00846138_00850133 NA coding downstream 152456 846059 ~ 850379 (+)
G418149 NA non-coding upstream 25867 666617 ~ 667483 (+)
G418148 NA non-coding upstream 28733 664260 ~ 664617 (+)
G418145 NA non-coding upstream 39447 653652 ~ 653903 (+)
G418142 NA non-coding upstream 48789 644260 ~ 644561 (+)
G418138 NA non-coding upstream 55892 637237 ~ 637458 (+)
G418180 NA non-coding downstream 232902 926505 ~ 926772 (+)
G418192 NA non-coding downstream 351313 1044916 ~ 1045411 (+)
G418195 NA non-coding downstream 353795 1047398 ~ 1047599 (+)
G418196 NA non-coding downstream 354655 1048258 ~ 1048495 (+)
G418197 NA non-coding downstream 356016 1049619 ~ 1049865 (+)
G418059 NA other upstream 128899 558092 ~ 564451 (+)
G417987 NA other upstream 465497 226703 ~ 227853 (+)
G418116 NA other downstream 179067 872670 ~ 875249 (+)
G418981 NA other downstream 1398891 2092494 ~ 2093678 (+)
G420445 NA other downstream 3609733 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 4479620 5173426 ~ 5176791 (+)
G421162 NA other downstream 5547630 6241233 ~ 6242997 (+)

Expression


Co-expression Network