G418667


Basic Information

Item Value
gene id G418667
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 1365014 ~ 1365559 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU480917
TGCCAGAATGAACAAACAGAAAGATCAATTACTGTTTTAACTCACGATATGTACGCAGGATAGACGAATCCAATGAGATTACAAAGAAGAGAAGCGCCGTATCCGATCACCAGATAAACTGCAATGAACGCGATGACAGCATATGCGATGTAGGACCTGCTCACTCCAGTCTTCGCTTCTATCTTCGCCAACACGTCCGTCATGACATTCTTCTCGTAAAGGAACTTGTCGAAACGTTCTTTTAGCGCGAAGGCCATGATTTGTCTGTATTTATGATTGCTTAATTATAGTATCAAATATAAATCATGAACAGCAGCTTAACTCCTGCTGCTCTCAGTTCAGTGTGACTTTGCACGCTGAGGGTGTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU480917 True 369 lncRNA 0.43 2 1365014 1365559

Neighbor

gene id symbol gene type direction distance location
CI01000304_01337171_01361506 CHD1 coding upstream 3508 1337171 ~ 1361506 (+)
CI01000304_01323957_01324596 C16H5ORF30, CUNH5ORF30 coding upstream 38692 1323957 ~ 1326322 (+)
CI01000304_01269500_01313976 PPIP5K2 coding upstream 50382 1268023 ~ 1314632 (+)
CI01000304_01173248_01184405 SH2D4A coding upstream 180485 1172137 ~ 1184529 (+)
CI01000304_00983004_01018406 NRG1 coding upstream 346321 982912 ~ 1018693 (+)
CI01000304_01366207_01367994 DCP2 coding downstream 561 1366120 ~ 1368002 (+)
CI01000304_01369056_01372878 DCP2 coding downstream 3037 1368596 ~ 1372972 (+)
CI01000304_01375020_01379551 NA coding downstream 9312 1374871 ~ 1379816 (+)
CI01000304_01392985_01399147 CA9 coding downstream 27426 1392985 ~ 1399153 (+)
CI01000304_01681164_01706159 ANKRD55 coding downstream 315605 1681164 ~ 1706397 (+)
G418691 NA non-coding upstream 32417 1332334 ~ 1332597 (+)
G418649 NA non-coding upstream 158038 1206710 ~ 1206976 (+)
G418113 NA non-coding upstream 158604 1205591 ~ 1206410 (+)
G418261 NA non-coding upstream 184997 1179814 ~ 1180017 (+)
G418257 NA non-coding upstream 198416 1166295 ~ 1166598 (+)
G418694 NA non-coding downstream 10402 1375961 ~ 1376294 (+)
G418701 NA non-coding downstream 16788 1382347 ~ 1382859 (+)
G418702 NA non-coding downstream 17455 1383014 ~ 1383342 (+)
G418666 NA non-coding downstream 73219 1438778 ~ 1447835 (+)
G418675 NA non-coding downstream 112990 1478549 ~ 1486508 (+)
G418116 NA other upstream 489765 872670 ~ 875249 (+)
G418059 NA other upstream 800563 558092 ~ 564451 (+)
G417987 NA other upstream 1137161 226703 ~ 227853 (+)
G418981 NA other downstream 726935 2092494 ~ 2093678 (+)
G420445 NA other downstream 2937777 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 3807664 5173426 ~ 5176791 (+)
G421162 NA other downstream 4875674 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 5987090 7352621 ~ 7354396 (+)

Expression


Co-expression Network