G419296


Basic Information

Item Value
gene id G419296
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 1746792 ~ 1748964 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU481615
GGCTTCCTGCTTGGATGTGCAATACGCCGTGAACATGATGCTTGTAAATTGGATACACTGATATGTTGTAACGCTCCAGTTTTTCAAAAACCAGTTAGTGTGGTGGTGTTGACATTGTGAGGAACTCTCTGCCAGTGTGGCTTAAGATCTCTTTGTTGCACATTCACCCACTCCACCAGGTATTCAGTCAGCGGAACGCTGCTAGGAGAAACTCCACTCCACTCCACCTGCAGCTCTTTATCACGCACTGACCAGCTTACATTCCTCACACCAGGAAGCTCTGATGGATCACAAGTGCATCACACATCACACACTTTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU481615 True 320 lncRNA 0.48 2 1746792 1748964

Neighbor

gene id symbol gene type direction distance location
CI01000304_01573427_01639447 MAP3K1 coding downstream 106953 1572399 ~ 1639839 (-)
CI01000304_01560571_01565345 HMGCS1 coding downstream 178516 1560368 ~ 1568276 (-)
CI01000304_01439737_01500518 TLN1 coding downstream 246152 1439302 ~ 1500640 (-)
CI01000304_01422089_01435801 TPM2 coding downstream 310991 1422089 ~ 1435801 (-)
CI01000304_01416856_01418996 NA coding downstream 327445 1416649 ~ 1419347 (-)
CI01000304_01764213_01809758 PAM coding upstream 14666 1763630 ~ 1809758 (-)
CI01000304_01839482_01853648 NA coding upstream 90506 1839470 ~ 1853793 (-)
CI01000304_01862046_01862663 DIRAS2.L, DIRAS2 coding upstream 112750 1861714 ~ 1862663 (-)
CI01000304_01897341_01897684 NA coding upstream 146888 1894422 ~ 1898210 (-)
CI01000304_01937620_01968424 AUH coding upstream 188656 1937620 ~ 1968936 (-)
G419285 NA non-coding downstream 102513 1644045 ~ 1644279 (-)
G419276 NA non-coding downstream 192387 1549416 ~ 1554405 (-)
CI01000304_01365055_01365447 NA non-coding downstream 381233 1364801 ~ 1365559 (-)
G419246 NA non-coding downstream 418395 1323971 ~ 1328397 (-)
G419239 NA non-coding downstream 429275 1317276 ~ 1317517 (-)
G419324 NA non-coding upstream 10992 1759956 ~ 1760297 (-)
G419387 NA non-coding upstream 153677 1902641 ~ 1903444 (-)
G419402 NA non-coding upstream 318279 2067243 ~ 2067756 (-)
G419353 NA other upstream 480420 2229384 ~ 2236106 (-)
G419354 NA other upstream 513538 2262502 ~ 2266241 (-)
CI01000304_04263955_04264962 NA other upstream 2514781 4263846 ~ 4265201 (-)
CI01000304_04661808_04672936 PPWD1 other upstream 2912852 4661766 ~ 4672947 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 4728487 6480743 ~ 6483986 (-)

Expression


Co-expression Network