G419006


Basic Information

Item Value
gene id G419006
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 2228641 ~ 2228848 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU481308
TAATTAAGGGATAATGTAGGCTACAGTCAGCCTACTGTCATTTTAAAGTCATTTTTAAAAACACTGAAATGTTAAAATATTTTTACAAGCTATGCAGGAACATTTTAGGCTTTTAATCATTTTAATTTAATGAAAGACTTATTTATTTATTTAACAGACAGTAATAACGGATATTGATTTTTGCTAAATTTTGAGCGCTTGAAATCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU481308 True 208 lncRNA 0.26 1 2228641 2228848

Neighbor

gene id symbol gene type direction distance location
CI01000304_02206338_02219356 NA coding upstream 8999 2206338 ~ 2219642 (+)
CI01000304_02136252_02167869 SEC31A coding upstream 60178 2136252 ~ 2168463 (+)
CI01000304_01877287_01890608 SYK coding upstream 337895 1875390 ~ 1890746 (+)
CI01000304_01829156_01835147 ST8SIA4 coding upstream 393476 1829156 ~ 1835165 (+)
CI01000304_01718700_01722248 NA coding upstream 506365 1718328 ~ 1722276 (+)
CI01000304_02229520_02235812 HNRNPDL coding downstream 291 2229139 ~ 2236204 (+)
CI01000304_02236583_02240921 HNRNPD coding downstream 7519 2236367 ~ 2241608 (+)
CI01000304_02254859_02262580 MAT2AL, METK1 coding downstream 25046 2253894 ~ 2264078 (+)
CI01000304_02267341_02290220 SNX30, SNX30.S coding downstream 38493 2267341 ~ 2290283 (+)
CI01000304_02558750_02584199 NA coding downstream 329902 2558750 ~ 2585195 (+)
G419001 NA non-coding upstream 41222 2186731 ~ 2187419 (+)
G418998 NA non-coding upstream 43848 2180561 ~ 2184793 (+)
G418980 NA non-coding upstream 142113 2086310 ~ 2086528 (+)
G418909 NA non-coding upstream 161778 2059352 ~ 2066863 (+)
G418886 NA non-coding upstream 302081 1926222 ~ 1926560 (+)
G419019 NA non-coding downstream 36918 2265766 ~ 2327739 (+)
G419081 NA non-coding downstream 194525 2423373 ~ 2423578 (+)
G419082 NA non-coding downstream 195129 2423977 ~ 2424792 (+)
G419083 NA non-coding downstream 196212 2425060 ~ 2425412 (+)
G418981 NA other upstream 134963 2092494 ~ 2093678 (+)
G418116 NA other upstream 1353392 872670 ~ 875249 (+)
G418059 NA other upstream 1664190 558092 ~ 564451 (+)
G417987 NA other upstream 2000788 226703 ~ 227853 (+)
G420445 NA other downstream 2074488 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 2944375 5173426 ~ 5176791 (+)
G421162 NA other downstream 4012385 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 5123801 7352621 ~ 7354396 (+)
G421435 NA other downstream 5255293 7484141 ~ 7484688 (+)

Expression


Co-expression Network