G419422


Basic Information

Item Value
gene id G419422
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 2421143 ~ 2421440 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU481784
ATAATAACTGCTGAAATATTTGCACGGAAAACGTTTCTCAGGTCAGTCAGAGGAGCGTGCATGGTACGAACAGTGCAGCTGCAGGCGCCACTGCGGCCACCCAACCCGTTCACATGAGAATGCGTATCAATAGTACGCGTGTGTAATCTCGTAGAAAATATATGCCAAAATGAGTTTTGGCATGCATATGATACGCACTTTATGGCGTGCATATAATACACTTTGTAGTCTTGGGTAGAGTTAGTGGTGTGGGTGCCCACGTGCCAGACGGACTTGGCCCGCGGGCCGCCAGTTGAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU481784 True 298 lncRNA 0.49 1 2421143 2421440

Neighbor

gene id symbol gene type direction distance location
CI01000304_02314977_02384157 NA coding downstream 36986 2314977 ~ 2384157 (-)
CI01000304_02299398_02304171 NA coding downstream 115981 2299143 ~ 2305162 (-)
CI01000304_02244094_02244588 NA coding downstream 176555 2240069 ~ 2244588 (-)
CI01000304_02220391_02227729 ENOPH, ENOPH1 coding downstream 192825 2219885 ~ 2228318 (-)
CI01000304_02184710_02202104 NA coding downstream 218734 2184403 ~ 2202409 (-)
CI01000304_02595522_02611332 GRIN3A coding upstream 174082 2595522 ~ 2611332 (-)
CI01000304_02694838_02711363 NA coding upstream 273220 2694660 ~ 2711502 (-)
CI01000304_02900497_02900924 NA coding upstream 478359 2899799 ~ 2902102 (-)
CI01000304_03158811_03160301 NA coding upstream 737053 3158493 ~ 3160301 (-)
CI01000304_03214897_03241215 MUSK coding upstream 792043 3213483 ~ 3241215 (-)
G419418 NA non-coding downstream 2358 2418483 ~ 2418785 (-)
G419356 NA non-coding downstream 181459 2236305 ~ 2239684 (-)
G419353 NA non-coding downstream 185037 2229384 ~ 2236106 (-)
G419363 NA non-coding downstream 259243 2102457 ~ 2161900 (-)
G419427 NA non-coding upstream 11909 2433349 ~ 2433582 (-)
G419428 NA non-coding upstream 17082 2438522 ~ 2438725 (-)
G419430 NA non-coding upstream 19073 2440513 ~ 2440798 (-)
G419440 NA non-coding upstream 56822 2478262 ~ 2478499 (-)
G419479 NA non-coding upstream 127101 2548541 ~ 2549110 (-)
G419354 NA other downstream 154902 2262502 ~ 2266241 (-)
CI01000304_04263955_04264962 NA other upstream 1842305 4263846 ~ 4265201 (-)
CI01000304_04661808_04672936 PPWD1 other upstream 2240376 4661766 ~ 4672947 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 4056011 6480743 ~ 6483986 (-)
G422354 NA other upstream 4209646 6631086 ~ 6631499 (-)
G422378 NA other upstream 4323239 6744679 ~ 6783046 (-)

Expression


Co-expression Network