G419081


Basic Information

Item Value
gene id G419081
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 2423373 ~ 2423578 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU481395
GTTTCCAGACTGATGGCAGCAACAATTGCTTCTTTAAGATCATTGCTGATTTCTTTCCTCCTTGGCATTGTGTTAACACATACTTGAAGGGTCCAGACACCCAAACTGCAGCTTTTATAGAGGTGATCACACACTTGCTAGTGATCAGTTAATCAAAGACATTTGATTAGCAGTACCTGACTGTTATTTACCCTCTTAAATTCCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU481395 True 206 lncRNA 0.39 1 2423373 2423578

Neighbor

gene id symbol gene type direction distance location
CI01000304_02267341_02290220 SNX30, SNX30.S coding upstream 133090 2267341 ~ 2290283 (+)
CI01000304_02254859_02262580 MAT2AL, METK1 coding upstream 159295 2253894 ~ 2264078 (+)
CI01000304_02236583_02240921 HNRNPD coding upstream 181765 2236367 ~ 2241608 (+)
CI01000304_02229520_02235812 HNRNPDL coding upstream 187169 2229139 ~ 2236204 (+)
CI01000304_02206338_02219356 NA coding upstream 203731 2206338 ~ 2219642 (+)
CI01000304_02558750_02584199 NA coding downstream 135172 2558750 ~ 2585195 (+)
CI01000304_02672677_02672967 NA coding downstream 249042 2672620 ~ 2673448 (+)
CI01000304_02810127_02814735 NA coding downstream 386549 2810127 ~ 2815076 (+)
CI01000304_02993734_03052509 EPHA5 coding downstream 570156 2993734 ~ 3054991 (+)
CI01000304_03127839_03154603 NA coding downstream 703015 3126593 ~ 3154797 (+)
G419019 NA non-coding upstream 95634 2265766 ~ 2327739 (+)
G419006 NA non-coding upstream 194525 2228641 ~ 2228848 (+)
G419001 NA non-coding upstream 235954 2186731 ~ 2187419 (+)
G418998 NA non-coding upstream 238580 2180561 ~ 2184793 (+)
G419082 NA non-coding downstream 399 2423977 ~ 2424792 (+)
G419083 NA non-coding downstream 1482 2425060 ~ 2425412 (+)
G419089 NA non-coding downstream 10386 2433964 ~ 2434172 (+)
G419092 NA non-coding downstream 16383 2439961 ~ 2440175 (+)
G419113 NA non-coding downstream 60754 2484332 ~ 2484602 (+)
G418981 NA other upstream 329695 2092494 ~ 2093678 (+)
G418116 NA other upstream 1548124 872670 ~ 875249 (+)
G418059 NA other upstream 1858922 558092 ~ 564451 (+)
G417987 NA other upstream 2195520 226703 ~ 227853 (+)
G420445 NA other downstream 1879758 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 2749645 5173426 ~ 5176791 (+)
G421162 NA other downstream 3817655 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 4929071 7352621 ~ 7354396 (+)
G421435 NA other downstream 5060563 7484141 ~ 7484688 (+)

Expression


Co-expression Network