G419430



Basic Information


Item Value
gene id G419430
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 2440513 ~ 2440798 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU481792
GCCGTGATGCGCTTTCATGACAGCACGATGAAACATGGGCAAGGACAGAATTTTCTATAGATTTCTATAAAGTTCTCATTATAATGCTATGTTTATGGCAGATTTGTGCTATATTTTCATCTACATTATTAAGTAATTCCATAAATCGCCTGCTCGTTTTCAAAGCCATACGAATTATCCTATGCCATTGAACAAATATGACGAAAAAAGCACTGCTGCATTATTATAAGTATTTTTATTTATGTATTTATTTATTTTTAAAAGAAATATCTAAAAGCAATATGAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU481792 True 286 lncRNA 0.30 1 2440513 2440798
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000304_02314977_02384157 NA coding downstream 56356 2314977 ~ 2384157 (-)
CI01000304_02299398_02304171 NA coding downstream 135351 2299143 ~ 2305162 (-)
CI01000304_02244094_02244588 NA coding downstream 195925 2240069 ~ 2244588 (-)
CI01000304_02220391_02227729 ENOPH, ENOPH1 coding downstream 212195 2219885 ~ 2228318 (-)
CI01000304_02184710_02202104 NA coding downstream 238104 2184403 ~ 2202409 (-)
CI01000304_02595522_02611332 GRIN3A coding upstream 154724 2595522 ~ 2611332 (-)
CI01000304_02694838_02711363 NA coding upstream 253862 2694660 ~ 2711502 (-)
CI01000304_02900497_02900924 NA coding upstream 459001 2899799 ~ 2902102 (-)
CI01000304_03158811_03160301 NA coding upstream 717695 3158493 ~ 3160301 (-)
CI01000304_03214897_03241215 MUSK coding upstream 772685 3213483 ~ 3241215 (-)
G419428 NA non-coding downstream 1788 2438522 ~ 2438725 (-)
G419427 NA non-coding downstream 6931 2433349 ~ 2433582 (-)
G419422 NA non-coding downstream 19073 2421143 ~ 2421440 (-)
G419418 NA non-coding downstream 21728 2418483 ~ 2418785 (-)
G419440 NA non-coding upstream 37464 2478262 ~ 2478499 (-)
G419479 NA non-coding upstream 107743 2548541 ~ 2549110 (-)
G419497 NA non-coding upstream 144607 2585405 ~ 2585713 (-)
G419498 NA non-coding upstream 147495 2588293 ~ 2589183 (-)
G419499 NA non-coding upstream 149169 2589967 ~ 2590299 (-)
G419354 NA other downstream 174272 2262502 ~ 2266241 (-)
G419353 NA other downstream 204407 2229384 ~ 2236106 (-)
CI01000304_04263955_04264962 NA other upstream 1822947 4263846 ~ 4265201 (-)
CI01000304_04661808_04672936 PPWD1 other upstream 2221018 4661766 ~ 4672947 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 4036653 6480743 ~ 6483986 (-)
G422354 NA other upstream 4190288 6631086 ~ 6631499 (-)
G422378 NA other upstream 4303881 6744679 ~ 6783046 (-)

Expression


G419430 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G419430 Expression in each Bioproject

Bar chart with 40 bars.
G419430 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network