G419113


Basic Information

Item Value
gene id G419113
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 2484332 ~ 2484602 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU481427
CGAATATGTCTGTGATTGGCTACAATGATCAACGCATGGCAGCGCTTGAAAGCACATGGAAGTGTTTGAATCTGAAAGCGTTTTGAAAGTGGGAGCATCAGCAGACTGGTCCGTGATAGACGCCTGCTTTCAAACGCTCCCGTGTGTATCCGTGTATGCGCTTGGTGAAGAGCGTCATTGATGAATATTTACAACGTTTTTACAGCATTGATCATTAAAGCCAATCACAGACATATCCGATGAGACGTGAAAACAATGGCCAATCAGAGGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU481427 True 271 lncRNA 0.45 1 2484332 2484602

Neighbor

gene id symbol gene type direction distance location
CI01000304_02267341_02290220 SNX30, SNX30.S coding upstream 194049 2267341 ~ 2290283 (+)
CI01000304_02254859_02262580 MAT2AL, METK1 coding upstream 220254 2253894 ~ 2264078 (+)
CI01000304_02236583_02240921 HNRNPD coding upstream 242724 2236367 ~ 2241608 (+)
CI01000304_02229520_02235812 HNRNPDL coding upstream 248128 2229139 ~ 2236204 (+)
CI01000304_02206338_02219356 NA coding upstream 264690 2206338 ~ 2219642 (+)
CI01000304_02558750_02584199 NA coding downstream 74148 2558750 ~ 2585195 (+)
CI01000304_02672677_02672967 NA coding downstream 188018 2672620 ~ 2673448 (+)
CI01000304_02810127_02814735 NA coding downstream 325525 2810127 ~ 2815076 (+)
CI01000304_02993734_03052509 EPHA5 coding downstream 509132 2993734 ~ 3054991 (+)
CI01000304_03127839_03154603 NA coding downstream 641991 3126593 ~ 3154797 (+)
G419092 NA non-coding upstream 44157 2439961 ~ 2440175 (+)
G419089 NA non-coding upstream 50160 2433964 ~ 2434172 (+)
G419083 NA non-coding upstream 58920 2425060 ~ 2425412 (+)
G419082 NA non-coding upstream 59540 2423977 ~ 2424792 (+)
G419081 NA non-coding upstream 60754 2423373 ~ 2423578 (+)
G419114 NA non-coding downstream 320 2484922 ~ 2485300 (+)
G419116 NA non-coding downstream 3175 2487777 ~ 2547208 (+)
G419115 NA non-coding downstream 53830 2538432 ~ 2550757 (+)
G419162 NA non-coding downstream 174521 2659123 ~ 2659415 (+)
G419542 NA non-coding downstream 201208 2685810 ~ 2690848 (+)
G418981 NA other upstream 390654 2092494 ~ 2093678 (+)
G418116 NA other upstream 1609083 872670 ~ 875249 (+)
G418059 NA other upstream 1919881 558092 ~ 564451 (+)
G417987 NA other upstream 2256479 226703 ~ 227853 (+)
G420445 NA other downstream 1818734 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 2688621 5173426 ~ 5176791 (+)
G421162 NA other downstream 3756631 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 4868047 7352621 ~ 7354396 (+)
G421435 NA other downstream 4999539 7484141 ~ 7484688 (+)

Expression


Co-expression Network