G419647


Basic Information

Item Value
gene id G419647
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 2818941 ~ 2819261 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU482024
CTGTAGTTATTGCTGTGTGCTGTTTGATGCTTCGACTTTTAGGAACACATGAGCTTGTATTATAAAGCGTTCCCAGATATTATTTATTTTTCTAAAAAACTTTGTTTGTGTTCATCTTAAGAAGGAAAGTCGTATACATCTCAGATAGCATGAGGGTAAAAAATGAGTAAACGGTGAGCACATTTCCGGGAGTACTGTACTTTCTTTTAATACAGAATAGCAAATGACATGGGATTCCCTCTTAAGATTCATCAGTGGAAAGAAAAAAAAAGAAGAAGAGGAACAAGAGGAGGAGGTAGCCAAGCAAGAGAAACAAATAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU482024 True 321 lncRNA 0.36 1 2818941 2819261

Neighbor

gene id symbol gene type direction distance location
CI01000304_02810127_02814735 NA coding upstream 3865 2810127 ~ 2815076 (+)
CI01000304_02672677_02672967 NA coding upstream 145493 2672620 ~ 2673448 (+)
CI01000304_02558750_02584199 NA coding upstream 233746 2558750 ~ 2585195 (+)
CI01000304_02267341_02290220 SNX30, SNX30.S coding upstream 528658 2267341 ~ 2290283 (+)
CI01000304_02254859_02262580 MAT2AL, METK1 coding upstream 554863 2253894 ~ 2264078 (+)
CI01000304_02993734_03052509 EPHA5 coding downstream 174473 2993734 ~ 3054991 (+)
CI01000304_03127839_03154603 NA coding downstream 307332 3126593 ~ 3154797 (+)
CI01000304_03193646_03207372 LPAR1 coding downstream 374127 3193388 ~ 3208382 (+)
CI01000304_03261474_03267659 RASSF6 coding downstream 442213 3261474 ~ 3268074 (+)
CI01000304_03278369_03283013 TMEM267 coding downstream 457047 3276308 ~ 3283183 (+)
G419636 NA non-coding upstream 18305 2800418 ~ 2800636 (+)
G419635 NA non-coding upstream 19120 2799554 ~ 2799821 (+)
G419542 NA non-coding upstream 128093 2685810 ~ 2690848 (+)
G419162 NA non-coding upstream 159526 2659123 ~ 2659415 (+)
G419115 NA non-coding upstream 268184 2538432 ~ 2550757 (+)
G419724 NA non-coding downstream 122435 2941696 ~ 2941950 (+)
G419802 NA non-coding downstream 258342 3077603 ~ 3077809 (+)
G419806 NA non-coding downstream 264862 3084123 ~ 3084345 (+)
G419808 NA non-coding downstream 276444 3095705 ~ 3095938 (+)
G418981 NA other upstream 725263 2092494 ~ 2093678 (+)
G418116 NA other upstream 1943692 872670 ~ 875249 (+)
G418059 NA other upstream 2254490 558092 ~ 564451 (+)
G417987 NA other upstream 2591088 226703 ~ 227853 (+)
G420445 NA other downstream 1484075 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 2353962 5173426 ~ 5176791 (+)
G421162 NA other downstream 3421972 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 4533388 7352621 ~ 7354396 (+)
G421435 NA other downstream 4664880 7484141 ~ 7484688 (+)

Expression


Co-expression Network