G420301


Basic Information

Item Value
gene id G420301
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 3759497 ~ 3759761 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU482731
TGATCAACTCTGAGCGTTTTCTTGTGGACTGTTTCCTGGTTTCTGTCGGATTGTTTATTCTTTGTGATTCTCTGCTGCCTGCCCTGAACCTTGCCTGTGTACTGGACTGTGTTTGTTTGCCGCCTGCCCTGATCTCTGCCTGTGACCCGATACTGTTTGTCTGCCGCCTGCCTCGACCCTTGCCTGTCCCTGTTTATGTTTTTGCCTTTGCCCCTGTCTACCTGTGTATCTACTATTCTTAATAAAGCTGCAAATGGATCCCCGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU482731 True 265 lncRNA 0.49 1 3759497 3759761

Neighbor

gene id symbol gene type direction distance location
CI01000304_03666156_03669795 NA coding upstream 88563 3666156 ~ 3670934 (+)
CI01000304_03615644_03617791 NA coding upstream 141089 3614933 ~ 3618408 (+)
CI01000304_03376929_03378015 NA coding upstream 381314 3376871 ~ 3378183 (+)
CI01000304_03353284_03357099 NA coding upstream 401933 3351741 ~ 3357564 (+)
CI01000304_03278369_03283013 TMEM267 coding upstream 476314 3276308 ~ 3283183 (+)
CI01000304_03975032_03978067 SIGMAR1, SIGMAR1.L coding downstream 215271 3975032 ~ 3978545 (+)
CI01000304_03984177_03996203 KATNAL2 coding downstream 224416 3984177 ~ 3996401 (+)
CI01000304_04170630_04190266 NA coding downstream 410869 4170630 ~ 4190266 (+)
CI01000304_04190428_04208535 NA coding downstream 430667 4190428 ~ 4208698 (+)
CI01000304_04223309_04223602 NA coding downstream 463548 4223309 ~ 4223769 (+)
G420295 NA non-coding upstream 15395 3743841 ~ 3744102 (+)
G420104 NA non-coding upstream 64129 3692700 ~ 3695368 (+)
G419940 NA non-coding upstream 370056 3389177 ~ 3389441 (+)
G419937 NA non-coding upstream 377734 3381523 ~ 3381763 (+)
G419875 NA non-coding upstream 380097 3287401 ~ 3379400 (+)
G420319 NA non-coding downstream 55532 3815293 ~ 3815758 (+)
G420330 NA non-coding downstream 74459 3834220 ~ 3834606 (+)
G420333 NA non-coding downstream 182691 3942452 ~ 4009996 (+)
G420454 NA non-coding downstream 303510 4063271 ~ 4063547 (+)
G420456 NA non-coding downstream 311942 4071703 ~ 4071957 (+)
G418981 NA other upstream 1665819 2092494 ~ 2093678 (+)
G418116 NA other upstream 2884248 872670 ~ 875249 (+)
G418059 NA other upstream 3195046 558092 ~ 564451 (+)
G417987 NA other upstream 3531644 226703 ~ 227853 (+)
G420445 NA other downstream 543575 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 1413462 5173426 ~ 5176791 (+)
G421162 NA other downstream 2481472 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 3592888 7352621 ~ 7354396 (+)
G421435 NA other downstream 3724380 7484141 ~ 7484688 (+)

Expression


Co-expression Network