G421795


Basic Information

Item Value
gene id G421795
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 4649365 ~ 4649665 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU484428
TCCCAAATTCAGTATCTCAGAAAATTAGAATATTGTGAAAAGGTTCAATATTGAAGACACCTGGTGCCACACTCTAATCAGCTAATTAACTCAAAACACCTGCAAAGGCCTTTAAATGGTCTCTCAGTCTAGTTCTGTAGGCTACACAATCATGGGGAAGACTGCTGACTTGACAGTTGTCCAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGGCACAAAAGGTCATTGCAAAAGAGGCTGGCTGTTCACAGAGCTCTGTGTCCAAGCACATTAATAGAGAGGCGAAGGGAAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU484428 True 301 lncRNA 0.44 1 4649365 4649665

Neighbor

gene id symbol gene type direction distance location
CI01000304_04579087_04595306 TJP2, TJP2A coding downstream 53025 4578438 ~ 4596340 (-)
CI01000304_04536971_04554186 MAMDC2B coding downstream 95179 4536971 ~ 4554186 (-)
CI01000304_04522897_04527887 SMC5 coding downstream 121478 4522849 ~ 4527887 (-)
CI01000304_04517750_04518058 NA coding downstream 131307 4517594 ~ 4518058 (-)
CI01000304_04458463_04459040 NA coding downstream 190131 4457613 ~ 4459234 (-)
CI01000304_04661808_04672936 PPWD1 coding upstream 12101 4661766 ~ 4672947 (-)
CI01000304_04789939_04792844 NA coding upstream 139774 4789439 ~ 4792844 (-)
CI01000304_04809176_04857217 CWC27 coding upstream 159511 4809176 ~ 4857217 (-)
CI01000304_04894865_04896532 CSN4, COPS4 coding upstream 245200 4894865 ~ 4896705 (-)
CI01000304_04914520_04932141 KIAA1958, E130308A19RIK, RGD1310951 coding upstream 264855 4914520 ~ 4932141 (-)
G421794 NA non-coding downstream 400 4648552 ~ 4648965 (-)
G421787 NA non-coding downstream 15418 4633717 ~ 4633947 (-)
G421785 NA non-coding downstream 16718 4632189 ~ 4632647 (-)
G421783 NA non-coding downstream 23820 4625312 ~ 4625545 (-)
G421782 NA non-coding downstream 24443 4624700 ~ 4624922 (-)
G421601 NA non-coding upstream 19989 4669654 ~ 4670066 (-)
G421860 NA non-coding upstream 130516 4780181 ~ 4780495 (-)
G421875 NA non-coding upstream 235909 4885574 ~ 4885773 (-)
G421884 NA non-coding upstream 258765 4908430 ~ 4908939 (-)
G421890 NA non-coding upstream 294126 4943791 ~ 4944002 (-)
CI01000304_04263955_04264962 NA other downstream 384164 4263846 ~ 4265201 (-)
G419354 NA other downstream 2383124 2262502 ~ 2266241 (-)
G419353 NA other downstream 2413259 2229384 ~ 2236106 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 1827786 6480743 ~ 6483986 (-)
G422354 NA other upstream 1981421 6631086 ~ 6631499 (-)
G422378 NA other upstream 2095014 6744679 ~ 6783046 (-)
G422810 NA other upstream 2980494 7630159 ~ 7652703 (-)

Expression


Co-expression Network