G421875


Basic Information

Item Value
gene id G421875
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 4885574 ~ 4885773 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU484511
GGATCTCTCCAGAACCAGGAAATGGAATGATTCATCGTGCAGCTTGCCTACTCATAGTTGGAGAGGTCCAACACGAAATCCAACATGACCCCGGCTGAGCGGTTTTCCAGTTACTGACTGGACTTGATAGGTGGTTTTGTTAGACCTCTTTTTGAGGTTGGGCTGGTGACAGAGGTCCCCTGATATGAAGTTGTCGGCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU484511 True 200 lncRNA 0.50 1 4885574 4885773

Neighbor

gene id symbol gene type direction distance location
CI01000304_04809176_04857217 CWC27 coding downstream 28357 4809176 ~ 4857217 (-)
CI01000304_04789939_04792844 NA coding downstream 92730 4789439 ~ 4792844 (-)
CI01000304_04661808_04672936 PPWD1 coding downstream 212638 4661766 ~ 4672947 (-)
CI01000304_04579087_04595306 TJP2, TJP2A coding downstream 289234 4578438 ~ 4596340 (-)
CI01000304_04536971_04554186 MAMDC2B coding downstream 331388 4536971 ~ 4554186 (-)
CI01000304_04894865_04896532 CSN4, COPS4 coding upstream 9092 4894865 ~ 4896705 (-)
CI01000304_04914520_04932141 KIAA1958, E130308A19RIK, RGD1310951 coding upstream 28747 4914520 ~ 4932141 (-)
CI01000304_04935603_04968053 HSDL2 coding upstream 49729 4935502 ~ 4968302 (-)
CI01000304_05039292_05067803 UGCG coding upstream 153213 5038986 ~ 5067814 (-)
CI01000304_05098315_05108511 CDC37L1 coding upstream 211864 5097637 ~ 5108511 (-)
G421860 NA non-coding downstream 105079 4780181 ~ 4780495 (-)
G421601 NA non-coding downstream 215508 4669654 ~ 4670066 (-)
G421795 NA non-coding downstream 235909 4649365 ~ 4649665 (-)
G421794 NA non-coding downstream 236609 4648552 ~ 4648965 (-)
G421787 NA non-coding downstream 251627 4633717 ~ 4633947 (-)
G421884 NA non-coding upstream 22657 4908430 ~ 4908939 (-)
G421890 NA non-coding upstream 58018 4943791 ~ 4944002 (-)
G421891 NA non-coding upstream 58358 4944131 ~ 4944346 (-)
G421905 NA non-coding upstream 143264 5029037 ~ 5029363 (-)
G421906 NA non-coding upstream 143637 5029410 ~ 5029694 (-)
CI01000304_04263955_04264962 NA other downstream 620373 4263846 ~ 4265201 (-)
G419354 NA other downstream 2619333 2262502 ~ 2266241 (-)
G419353 NA other downstream 2649468 2229384 ~ 2236106 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 1591678 6480743 ~ 6483986 (-)
G422354 NA other upstream 1745313 6631086 ~ 6631499 (-)
G422378 NA other upstream 1858906 6744679 ~ 6783046 (-)
G422810 NA other upstream 2744386 7630159 ~ 7652703 (-)
G423386 NA other upstream 3976450 8862223 ~ 8865296 (-)

Expression


Co-expression Network