G421884



Basic Information


Item Value
gene id G421884
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 4908430 ~ 4908939 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU484524
TCGGCCTTGAAGTTGCTTCAGATGTTGATAAACCATTGAGTGAAAGCCTGGCTTGAGTCTGTATGGGAGTGGCTGTTGAGAAGGTGGAGCTGCTGGTCAAAGTCACAAATGCAGGCTGGGGGAGCTGCGTAACGTATGGGGCTGGCAACACAGCGTAGCCCATGTTTCCAGAGCCGTGGGCGGGGGCGAGCACAGTGCCAGGCGGCAGGTTGGTGAGGTTAGGCTGGATCTGTGGCAGATGTGTGGCTGGCATGATGAGACGCTGGGGGGTCTGACTGGTGGTCACCACCTGAGCTGCTGACGTCAAGGGTTTGGGTACAACCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU484524 True 324 lncRNA 0.57 3 4908430 4908939
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000304_04894865_04896532 CSN4, COPS4 coding downstream 11725 4894865 ~ 4896705 (-)
CI01000304_04809176_04857217 CWC27 coding downstream 51213 4809176 ~ 4857217 (-)
CI01000304_04789939_04792844 NA coding downstream 115586 4789439 ~ 4792844 (-)
CI01000304_04661808_04672936 PPWD1 coding downstream 235494 4661766 ~ 4672947 (-)
CI01000304_04579087_04595306 TJP2, TJP2A coding downstream 312090 4578438 ~ 4596340 (-)
CI01000304_04914520_04932141 KIAA1958, E130308A19RIK, RGD1310951 coding upstream 5581 4914520 ~ 4932141 (-)
CI01000304_04935603_04968053 HSDL2 coding upstream 26563 4935502 ~ 4968302 (-)
CI01000304_05039292_05067803 UGCG coding upstream 130047 5038986 ~ 5067814 (-)
CI01000304_05098315_05108511 CDC37L1 coding upstream 188698 5097637 ~ 5108511 (-)
CI01000304_05139300_05146419 NA coding upstream 230184 5139123 ~ 5146728 (-)
G421875 NA non-coding downstream 22657 4885574 ~ 4885773 (-)
G421860 NA non-coding downstream 127935 4780181 ~ 4780495 (-)
G421601 NA non-coding downstream 238364 4669654 ~ 4670066 (-)
G421795 NA non-coding downstream 258765 4649365 ~ 4649665 (-)
G421794 NA non-coding downstream 259465 4648552 ~ 4648965 (-)
G421890 NA non-coding upstream 34852 4943791 ~ 4944002 (-)
G421891 NA non-coding upstream 35192 4944131 ~ 4944346 (-)
G421905 NA non-coding upstream 120098 5029037 ~ 5029363 (-)
G421906 NA non-coding upstream 120471 5029410 ~ 5029694 (-)
G421907 NA non-coding upstream 121275 5030214 ~ 5030946 (-)
CI01000304_04263955_04264962 NA other downstream 643229 4263846 ~ 4265201 (-)
G419354 NA other downstream 2642189 2262502 ~ 2266241 (-)
G419353 NA other downstream 2672324 2229384 ~ 2236106 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 1568512 6480743 ~ 6483986 (-)
G422354 NA other upstream 1722147 6631086 ~ 6631499 (-)
G422378 NA other upstream 1835740 6744679 ~ 6783046 (-)
G422810 NA other upstream 2721220 7630159 ~ 7652703 (-)
G423386 NA other upstream 3953284 8862223 ~ 8865296 (-)

Expression


G421884 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G421884 Expression in each Bioproject

Bar chart with 39 bars.
G421884 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network