G420580


Basic Information

Item Value
gene id G420580
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 5218151 ~ 5218664 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU483072
ACAACATTGAGCATAAGGAAGAAAAATAAAAGCTTTGAATTTATAAAAAAAAAATAAAAAAAAAATACAGATAAATCGCAATACAATATTTCAGACAGGGTCCCTCTGTTCCAATGTTTTTTTCAAATGTTTTTTAATGCCTTAAATGGTGGGGGTTAGACATAAGTCTATGTTTGATCGTCTTGCCTGTAAAGCTGCGATCTGGTTGTCTGGGCTGGTTTGTAGGTGTTGCCTCCAGCAGCGGCTCTAGATGCTCCGTCCCTTCAGGAACCCGCTTAGGGTCCCATTCTCCAGAGCAGAACAGCTTAACAGTCTTTCCCATAGAGCTGTGCACCTCACACATCGCTGAGAAATTTAAAGAGAGAGAGAAATAGATGAAGTAACCATCACAGACACAAATAATATGACAAAATGAGCCTTAAAAGTTCTTCAGAAGAAGCATAGGACAAGAAAACGCCCGGCAATGTTAAATCAATAAGAAACGAAACTGACACAACATGGCATGCTTTATGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU483072 True 514 lncRNA 0.39 1 5218151 5218664

Neighbor

gene id symbol gene type direction distance location
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB coding upstream 42626 5173426 ~ 5176791 (+)
CI01000304_05149465_05165999 NA coding upstream 51979 5148697 ~ 5166172 (+)
CI01000304_05122605_05137890 EXD3 coding upstream 79982 5122605 ~ 5138169 (+)
CI01000304_05085761_05095609 AK3 coding upstream 121900 5085596 ~ 5096251 (+)
CI01000304_04989817_04997932 NA coding upstream 220219 4988362 ~ 4997932 (+)
CI01000304_05277392_05292162 DBH coding downstream 58437 5277101 ~ 5292162 (+)
CI01000304_05394708_05400373 NA coding downstream 175188 5393852 ~ 5400616 (+)
CI01000304_05489571_05504308 NA coding downstream 270861 5489525 ~ 5508080 (+)
CI01000304_05541965_05547732 NA coding downstream 322874 5541538 ~ 5547877 (+)
CI01000304_05584729_05612753 STRBP coding downstream 366065 5584729 ~ 5612798 (+)
G420790 NA non-coding upstream 3268 5214385 ~ 5214883 (+)
G420789 NA non-coding upstream 3801 5214114 ~ 5214350 (+)
G420577 NA non-coding upstream 5524 5211827 ~ 5212627 (+)
G420788 NA non-coding upstream 8146 5209597 ~ 5210005 (+)
G420787 NA non-coding upstream 8632 5208774 ~ 5209519 (+)
G420791 NA non-coding downstream 5 5218669 ~ 5219080 (+)
G420541 NA non-coding downstream 918 5219582 ~ 5219951 (+)
G420558 NA non-coding downstream 6989 5225653 ~ 5225936 (+)
G420621 NA non-coding downstream 7472 5226136 ~ 5226434 (+)
G420550 NA non-coding downstream 8114 5226778 ~ 5227468 (+)
G420445 NA other upstream 914319 4303336 ~ 4303832 (+)
G418981 NA other upstream 3124473 2092494 ~ 2093678 (+)
G418116 NA other upstream 4342902 872670 ~ 875249 (+)
G418059 NA other upstream 4653700 558092 ~ 564451 (+)
G421162 NA other downstream 1022569 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 2133985 7352621 ~ 7354396 (+)
G421435 NA other downstream 2265477 7484141 ~ 7484688 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A other downstream 2759964 7979078 ~ 7980735 (+)
CI01000304_08232073_08235598 NA other downstream 3013330 8231293 ~ 8235655 (+)

Expression


Co-expression Network