G420824


Basic Information

Item Value
gene id G420824
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 5294640 ~ 5295422 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU483323
AGCAGACAGCTTAAAGGCCAGACTTTAGAAAGAATTACTATTACTATCAATGAGGAAATAGGTTAAAACACAGTAAAATATTAATTTAAGTCACAGTACATGGGTGAGGGAATGAACTGATGGTCCAACATGCAGAAACATGTTCAGTTTCTCTCTTTCTGTCTGGACAATACAGCGTTTAAGATGATTTGTAACCTCTGTAAATACTGAACTCAGTCTGAATCAATTACATTCTGGCCTTGTGCACTCCGCCGTGATTTTGTGGAGAGCTGTAGATGCCCTTAACGCGCTTGTTTTCGGGGTCAAAGGGTGATTTCAGGTGAGCTGTAGCCTTATATGTGACGCCCATCCTCTCCAGGGTGAATTCGCCACTGCGGATGAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU483323 True 383 lncRNA 0.42 2 5294640 5295422

Neighbor

gene id symbol gene type direction distance location
CI01000304_05277392_05292162 DBH coding upstream 2478 5277101 ~ 5292162 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB coding upstream 119115 5173426 ~ 5176791 (+)
CI01000304_05149465_05165999 NA coding upstream 128468 5148697 ~ 5166172 (+)
CI01000304_05122605_05137890 EXD3 coding upstream 156471 5122605 ~ 5138169 (+)
CI01000304_05085761_05095609 AK3 coding upstream 198389 5085596 ~ 5096251 (+)
CI01000304_05394708_05400373 NA coding downstream 98430 5393852 ~ 5400616 (+)
CI01000304_05489571_05504308 NA coding downstream 194103 5489525 ~ 5508080 (+)
CI01000304_05541965_05547732 NA coding downstream 246116 5541538 ~ 5547877 (+)
CI01000304_05584729_05612753 STRBP coding downstream 289307 5584729 ~ 5612798 (+)
CI01000304_05828658_05832773 MORN5 coding downstream 533236 5828658 ~ 5832803 (+)
G420795 NA non-coding upstream 62903 5231311 ~ 5231737 (+)
G420793 NA non-coding upstream 65348 5229030 ~ 5229292 (+)
G420792 NA non-coding upstream 66142 5228264 ~ 5228498 (+)
G420550 NA non-coding upstream 67172 5226778 ~ 5227468 (+)
G420621 NA non-coding upstream 68206 5226136 ~ 5226434 (+)
G420835 NA non-coding downstream 93228 5388650 ~ 5389326 (+)
G420879 NA non-coding downstream 182941 5478363 ~ 5478672 (+)
G420881 NA non-coding downstream 185452 5480874 ~ 5481156 (+)
G420886 NA non-coding downstream 194562 5489984 ~ 5490217 (+)
G420445 NA other upstream 990808 4303336 ~ 4303832 (+)
G418981 NA other upstream 3200962 2092494 ~ 2093678 (+)
G418116 NA other upstream 4419391 872670 ~ 875249 (+)
G418059 NA other upstream 4730189 558092 ~ 564451 (+)
G421162 NA other downstream 945811 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 2057227 7352621 ~ 7354396 (+)
G421435 NA other downstream 2188719 7484141 ~ 7484688 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A other downstream 2683206 7979078 ~ 7980735 (+)
CI01000304_08232073_08235598 NA other downstream 2936572 8231293 ~ 8235655 (+)

Expression


Co-expression Network