G421043


Basic Information

Item Value
gene id G421043
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 5958110 ~ 5958343 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU483578
CAAATTTTGAAAAGATTTAGCTGGGAGAACATCTAGCAACTAATTAAGTTAATTGATATCAGGTCTGTAACATGATTAGCTATAAAAGGGATGTCTTAGAGAGGCAGAGTCTCTCAGAAGTAAAGATGGGCAGAGGCTCTCTAATCTGAAAGAGTGCATAAAAAGATTGTGGAATACTTTAAAAACAATGTTCCTCAATGTCAAATTGTAAAGGTTTTGCAAATCTCATCATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU483578 True 234 lncRNA 0.34 1 5958110 5958343

Neighbor

gene id symbol gene type direction distance location
CI01000304_05934136_05935124 NA coding upstream 22323 5934136 ~ 5935787 (+)
CI01000304_05931192_05933816 NA coding upstream 24294 5931192 ~ 5933816 (+)
CI01000304_05880320_05907760 NA coding upstream 50350 5880155 ~ 5907760 (+)
CI01000304_05828658_05832773 MORN5 coding upstream 125307 5828658 ~ 5832803 (+)
CI01000304_05584729_05612753 STRBP coding upstream 345312 5584729 ~ 5612798 (+)
CI01000304_05965390_05976384 NA coding downstream 6878 5965221 ~ 5980978 (+)
CI01000304_06006140_06015169 ARL15, ARL15B coding downstream 47743 6006086 ~ 6015802 (+)
CI01000304_06052958_06060880 MOCS2 coding downstream 94615 6052958 ~ 6060933 (+)
CI01000304_06215366_06219149 GOLPH3 coding downstream 256752 6215095 ~ 6219740 (+)
CI01000304_06315989_06316538 NA coding downstream 357090 6315433 ~ 6316538 (+)
G420967 NA non-coding upstream 10330 5940693 ~ 5947780 (+)
G421015 NA non-coding upstream 69349 5838046 ~ 5888761 (+)
G420969 NA non-coding upstream 129832 5824182 ~ 5828278 (+)
G421009 NA non-coding upstream 136335 5821194 ~ 5821775 (+)
G421008 NA non-coding upstream 137664 5820050 ~ 5820446 (+)
G421067 NA non-coding downstream 155002 6113345 ~ 6113593 (+)
G421068 NA non-coding downstream 157955 6116298 ~ 6116679 (+)
G421069 NA non-coding downstream 160181 6118524 ~ 6118733 (+)
G420977 NA non-coding downstream 162449 6120792 ~ 6123362 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other upstream 781319 5173426 ~ 5176791 (+)
G420445 NA other upstream 1654278 4303336 ~ 4303832 (+)
G418981 NA other upstream 3864432 2092494 ~ 2093678 (+)
G418116 NA other upstream 5082861 872670 ~ 875249 (+)
G418059 NA other upstream 5393659 558092 ~ 564451 (+)
G421162 NA other downstream 282890 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 1394306 7352621 ~ 7354396 (+)
G421435 NA other downstream 1525798 7484141 ~ 7484688 (+)
CI01000304_07979388_07979919 TMEM230, TMEM230A other downstream 2020285 7979078 ~ 7980735 (+)
CI01000304_08232073_08235598 NA other downstream 2273651 8231293 ~ 8235655 (+)

Expression


Co-expression Network