G422227


Basic Information

Item Value
gene id G422227
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 6227526 ~ 6227827 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU484917
CAAGTATGGCTACAGTAGAGGGAAACTAGCGATGACTCCCAAGGAGCTTGTGGAAGACTCGTGGCTTCCTGTCCTAGTTCATGCCTCCCGCGCTCCTTCCAGTGTGACGGGTGGCTCTAGTGCACAGAATAGGGATCGCAGGGCCAGAGAAGGTTGGGGGTCTGACAAGGGAAAGGTTCCTGTCCAGGGAAATCCTGTCTTTCAACAGATTCACATCGTGGTTCAGGACCCTCACTGTGTCTTTGAGTCCCTTAGGGACTGTTAGCTCAAAACTGCCGCTCTGCCGATTGTCTGACAAAGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU484917 True 302 lncRNA 0.54 1 6227526 6227827

Neighbor

gene id symbol gene type direction distance location
CI01000304_06222605_06223109 NA coding downstream 3252 6221146 ~ 6224274 (-)
CI01000304_06204719_06212827 NA coding downstream 14350 6204106 ~ 6213176 (-)
CI01000304_06123328_06162242 ITGA1 coding downstream 65284 6120800 ~ 6162242 (-)
CI01000304_06092291_06110594 ITGA2 coding downstream 116882 6091994 ~ 6110644 (-)
CI01000304_06063226_06079147 ITGA2.2 coding downstream 148379 6063226 ~ 6079147 (-)
CI01000304_06234231_06236303 NA coding upstream 6378 6234205 ~ 6236409 (-)
CI01000304_06240590_06242902 APLNRB coding upstream 12639 6240466 ~ 6243012 (-)
CI01000304_06270879_06289706 TBC1D10AB coding upstream 41366 6267565 ~ 6290510 (-)
CI01000304_06300308_06314871 PPTC7A, PPTC7B, PPTC7.S, PPTC7 coding upstream 70878 6298705 ~ 6315061 (-)
CI01000304_06324113_06327228 HVCN1 coding upstream 96264 6324091 ~ 6328179 (-)
G422217 NA non-coding downstream 39516 6187732 ~ 6188010 (-)
G422214 NA non-coding downstream 45093 6182133 ~ 6182433 (-)
G422164 NA non-coding downstream 115087 6060806 ~ 6112439 (-)
G422189 NA non-coding downstream 188803 6038426 ~ 6038723 (-)
G422228 NA non-coding upstream 162 6227989 ~ 6228259 (-)
G422229 NA non-coding upstream 713 6228540 ~ 6228897 (-)
G422231 NA non-coding upstream 3115 6230942 ~ 6231168 (-)
G422232 NA non-coding upstream 3395 6231222 ~ 6231467 (-)
G422240 NA non-coding upstream 35935 6263762 ~ 6264045 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 1554579 4661766 ~ 4672947 (-)
CI01000304_04263955_04264962 NA other downstream 1962325 4263846 ~ 4265201 (-)
G419354 NA other downstream 3961285 2262502 ~ 2266241 (-)
G419353 NA other downstream 3991420 2229384 ~ 2236106 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 249624 6480743 ~ 6483986 (-)
G422354 NA other upstream 403259 6631086 ~ 6631499 (-)
G422378 NA other upstream 516852 6744679 ~ 6783046 (-)
G422810 NA other upstream 1402332 7630159 ~ 7652703 (-)
G423386 NA other upstream 2634396 8862223 ~ 8865296 (-)

Expression


Co-expression Network