G422332



Basic Information


Item Value
gene id G422332
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 6560486 ~ 6560717 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU485059
TTCACATTGGCCGCAATTATTGGCACCCAATTATTGCAACCTCCTTTTGCCAACAAGTCTTTTTCTAAAATGCCTGATGAGTTTGGAGAACACCTGACAAGAGATCAGAGATCATTCCTTCATACAGAATCTCTACAGATCCTTCAGATTCCCAGCTCCATGTTGGTGCTTCTTCTCTTCAGTTCACTCCACTCATTTTCTTTAGGGTTCAGGTCAGGGAACTGGGACGGCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU485059 True 232 lncRNA 0.44 1 6560486 6560717
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000304_06515961_06519125 NA coding downstream 41361 6515896 ~ 6519125 (-)
CI01000304_06507688_06509486 NA coding downstream 50864 6507542 ~ 6509622 (-)
CI01000304_06489010_06490993 NA coding downstream 68292 6488028 ~ 6492194 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 coding downstream 76500 6480743 ~ 6483986 (-)
CI01000304_06473293_06476260 NA coding downstream 84120 6473293 ~ 6476366 (-)
CI01000304_06659869_06667425 NA coding upstream 99107 6659824 ~ 6667499 (-)
CI01000304_06706476_06715064 GGCX coding upstream 145353 6706070 ~ 6715064 (-)
CI01000304_06725873_06727044 NA coding upstream 164982 6725699 ~ 6727044 (-)
CI01000304_06738434_06742551 STOML2.L, STOML2, STML2 coding upstream 177537 6738254 ~ 6742551 (-)
CI01000304_06867535_06870134 NA coding upstream 306400 6867117 ~ 6870134 (-)
G422331 NA non-coding downstream 477 6559787 ~ 6560009 (-)
G422321 NA non-coding downstream 41041 6510991 ~ 6519445 (-)
G422318 NA non-coding downstream 59455 6500719 ~ 6501031 (-)
G422256 NA non-coding downstream 111991 6447744 ~ 6448495 (-)
G422246 NA non-coding downstream 235492 6324459 ~ 6324994 (-)
G422343 NA non-coding upstream 51051 6611768 ~ 6612117 (-)
G422353 NA non-coding upstream 69861 6630578 ~ 6630875 (-)
G422355 NA non-coding upstream 70934 6631651 ~ 6633786 (-)
G422357 NA non-coding upstream 75116 6635833 ~ 6636140 (-)
G422359 NA non-coding upstream 76509 6637226 ~ 6637448 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 1887539 4661766 ~ 4672947 (-)
CI01000304_04263955_04264962 NA other downstream 2295285 4263846 ~ 4265201 (-)
G419354 NA other downstream 4294245 2262502 ~ 2266241 (-)
G419353 NA other downstream 4324380 2229384 ~ 2236106 (-)
G422354 NA other upstream 70369 6631086 ~ 6631499 (-)
G422378 NA other upstream 183962 6744679 ~ 6783046 (-)
G422810 NA other upstream 1069442 7630159 ~ 7652703 (-)
G423386 NA other upstream 2301506 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 3007639 9566730 ~ 9575706 (-)

Expression


G422332 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G422332 Expression in each Bioproject

Bar chart with 17 bars.
G422332 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network